BBa_K2050419 1 BBa_K2050419 RNA Polimerase III Promoter (H1 promoter) 2016-09-15T11:00:00Z 2016-09-16T10:00:43Z Genomic sequence of Homo sapiens. H1 promoter could be used to present eRNA11a in the cell, activating an IFN?? reporter in human. false false _2518_ 30510 30510 9 false We are optimising the coding sequence to work even better in human. false Putra Mahanaim Tampubolon annotation2483688 1 H1 promoter range2483688 1 1 97 BBa_K2050419_sequence 1 catgcaaattacgcgctgtgctttgtgggaaatcaccctaaacgtaaaatttattcctctttcgagccttatagtggcggccggtctacaccctaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z