BBa_K2050420 1 BBa_K2050420 Enhanced green fluorescent protein (EGFP) coding sequence (human-optimized) 2016-10-12T11:00:00Z 2016-10-13T09:38:35Z The amino acid sequence was obtained from www.uniprot.org (accession number C5MKY7); the DNA sequence is our own. The green fluorescent protein (GFP) is a protein originally obtained from the jellyfish Aequorea victoria that emits green fluorescence upon exposure to light in the blue to ultraviolet range and is typically used in molecular biology and genetics as a reporter. The enhanced GFP (or EGFP) was developed to allow for its practical usage in mammalian cells. false false _2518_ 30522 30522 9 false The amino acid sequence was entered into IDT's online codon optimization tool to obtain the first DNA sequence, which was subsequently run through several rounds of manual optimization. At each round, the sequence was run through GenScript's online rare codon analysis tool to evaluate the codon optimization index (CAI), frequency of rare codons, GC content and negative cis or repeat elements. The rounds of manual optimization aims to eliminate possible bacterial or mammalian promoters, AGG codons, Chi sites, ter sites, dem sites, polyadenylation sites, Pasteurellaceae or Neisseriaceae DNA uptake sequences, K12 methylation sites, TATA boxes, palindromes and splice sites. false Muhammad Farhan Maruli BBa_K2050420_sequence 1 atggtgtccaaaggggaagagctgtttaccggcgtggtgcctatcctcgtggagctggatggggatgtgaatggccacaagttttccgtgagcggagagggagagggggacgccacatatggcaagctcacactcaagtttatctgcacaacaggcaagctgccagtgccttggcctacactggtgaccacactgacctatggagtgcagtgcttttcccggtatcctgaccatatgaagcagcatgatttctttaagtccgccatgcctgaaggctatgtgcaggagagaaccatcttctttaaggatgatggaaactataagaccagagctgaagtgaagtttgagggcgatactctggtgaacagaatcgagctgaaaggcattgattttaaagaggatggaaatattctgggccacaaactggagtacaattataattcccacaacgtgtacatcatggcagataaacagaaaaacggcatcaaggtcaattttaagatcagacacaatatcgaggatggctccgtgcagctggctgaccattatcagcagaatacccctatcggggatggccctgtcctcctgcctgataatcactatctgtccacccagtccgccctgtccaaggaccctaatgagaagagagatcacatggtgctgctggagtttgtgaccgcagctggcatcacactgggcatggatgagctgtataagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z