BBa_K2053001 1 CBPa-BpA Fusion cellulose-binding domain of CBP-B domain of protein A 2016-10-10T11:00:00Z 2016-10-12T01:01:26Z Cellulose-binding domain of cellulose-binding protein A was taken from iGEM Bielefeld-Germany 2012 team (BBa_K863110) and B domain of protein A was taken from iGEM Warsaw 2008 (BBa_K103003). It is a fusion protein between the Clostridium cellulovorans cellulose-binding domain of cellulose-binding protein A (CBPa) with the B domain of staphylococcus aureus protein A (BpA). This fusion protein is used to bind antibodies to cellulose. We use these functions to functionalize a cellulose-based patch into an immunodetection-based system. true false _2521_ 31618 31618 9 Not in stock false Polyhistidine tag (6 His) sequence was added at the 5'end as well as pET43.1a-derived Lac operator, ribosome-binding site (RBS), and T7 terminator. false Mathieu Hubert annotation2492995 1 pET43.1a range2492995 1 1 36 annotation2492998 1 His-Tag range2492998 1 40 57 annotation2492997 1 Start codon range2492997 1 37 39 annotation2492999 1 TEV cleavage site range2492999 1 58 78 annotation2493000 1 CBPa range2493000 1 79 384 annotation2493003 1 Stop codon range2493003 1 643 645 annotation2493004 1 Stop codon range2493004 1 646 648 annotation2492996 1 RBS range2492996 1 23 28 annotation2493005 1 Terminator T7 range2493005 1 649 695 annotation2493001 1 Linker range2493001 1 385 420 annotation2493002 1 BpA range2493002 1 421 642 BBa_K2053001_sequence 1 aataattttgtttaactttaagaaggagatatacatatgcatcaccatcaccatcacgaaaacctgtattttcagggcgccggctcatcaatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaattactaacacatctgacagtgatttaaatttaaatgacgtaaaagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaaccggtggcggtgcgggcagcggtagcggtggcagcggcgcgtctaaaaccgcggcgctggcgcagcacgacgaagcggttgacaacaaattcaacaaagaacagcagaacgcgttctacgaaatcctgcacctgccgaacctgaacgaagaacagcgtaacgcgttcatccagtctctgaaagacgacccgtctcagtctgcgaacctgctggcggaagcgaaaaaactgaacgacgcgcaggcgccgaaagttgacggttcttaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z