BBa_K2053002 1 Si4-CBPa-B Fusion Si4-cellulose-binding domain-B domain protein A 2016-10-10T11:00:00Z 2016-10-11T05:19:06Z Silica-binding peptide (Si4) was taken from iGEM Leeds 2013 (BBa_K1028000), cellulose-binding domain of cellulose-binding protein A was taken from iGEM Bielefeld-Germany 2012 team (BBa_K863110) and B domain of protein A was taken from iGEM Warsaw 2008 (BBa_K103003). It is a fusion protein between the phage displayed silica-binding peptide (Si4) developed by Naik et al (Journal of Nanoscience and Nanotechnology, Volume 2, Number 1, February 2002, pp. 95-100(6)), the Clostridium cellulovorans cellulose-binding domain of cellulose-binding protein A (CBPa) with the B domain of staphylococcus aureus protein A (BpA). This fusion protein is used to bind silica and antibodies to cellulose. We use these functions to functionalize a silica-cellulose composite-based patch into an immunodetection-based system. false false _2521_ 31618 31618 9 false Polyhistidine tag (6 His) was added at the N-terminal end as well as linkers to join Si4 to CBPa and also CBPa to BpA. pET43.1a-derived ribosome-binding site (RBS) and T7 terminator were added. false Mathieu Hubert annotation2493022 1 Stop codon range2493022 1 724 726 annotation2493021 1 BpA range2493021 1 502 723 annotation2493020 1 Linker 2 range2493020 1 466 501 annotation2493012 1 pET43.1a range2493012 1 1 36 annotation2493013 1 RBS range2493013 1 23 28 annotation2493019 1 CBPa range2493019 1 160 465 annotation2493015 1 His-Tag range2493015 1 40 57 annotation2493023 1 Stop codon range2493023 1 727 729 annotation2493014 1 Start codon range2493014 1 37 39 annotation2493018 1 Linker 1 range2493018 1 124 159 annotation2493016 1 TEV cleavage site range2493016 1 58 78 annotation2493017 1 Si4 range2493017 1 79 123 annotation2493024 1 Terminator T7 range2493024 1 730 776 BBa_K2053002_sequence 1 aataattttgtttaactttaagaaggagatatacatatgcatcaccatcaccatcacgaaaacctgtattttcagggcggcggtgggactcatcaccatcgccctcatccacatccgtcgatgggcagcgcgggcagcgcggcgggcagcggcgaatttgccggctcatcaatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaattactaacacatctgacagtgatttaaatttaaatgacgtaaaagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaaccggtggcggtgcgggcagcggtagcggtggcagcggcgcgtctaaaaccgcggcgctggcgcagcacgacgaagcggttgacaacaaattcaacaaagaacagcagaacgcgttctacgaaatcctgcacctgccgaacctgaacgaagaacagcgtaacgcgttcatccagtctctgaaagacgacccgtctcagtctgcgaacctgctggcggaagcgaaaaaactgaacgacgcgcaggcgccgaaagttgacggttcttaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z