BBa_K2054004 1 O4 Oligo 4 of DNA Tetrahedral Nanostructure 2016-10-13T11:00:00Z 2016-10-27T11:57:02Z Elbaz, J., Yin, P., & Voigt, C. A. (2016). Genetic encoding of DNA nanostructures and their self-assembly in living bacteria. Nature communications, 7. This will be used to build our desired nanostructure that target micro RNA biomarkers. This plasmid encodes the second ssDNA that will make the tetrahedral nanostructure, together with oligo 1, 2, 3 and 5. false false _2522_ 0 30316 30316 9 It's complicated false The assembly of the structure. false LAI HEI WAI BBa_K2054004_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcatgtgacagtgcactctgacacacgcatgacgctatcgcagctgtgctgctgagtactactagctgcacgtgtgatgacgagacaaaaaaaacgggcgcggatagctcagtcggtagagcatcagacttttaatctgagggtccagggttcaagcgcccgttttttttcgtcgcaggagtcactaagggttagttagttagattagcagaaagtcaaaagcctccgaccggaggcttttgactaaaacttcccttggggttatcattggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z