BBa_K2055003 1 BBa_K2055003 Iron oxidase 2016-09-28T11:00:00Z 2016-09-29T04:06:38Z The sequence of the iron oxidase was obtained from UniProt. It corresponds to the IRO gene of Acidithiobacillus ferrooxidans, accession number P50500. Codes for the enzyme iron oxidase, which catalyzes the oxidation of Fe+2 to Fe+3. false false _2523_ 11825 11825 9 false It was optimised for Escherichia coli. false Carolina Elizondo BBa_K2055003_sequence 1 atgggatcaatgccgaaggcagcggtgcaataccaagatacacctaaaggaaaagatcattgttcggtatgtgctcagtttattgctccccattcgtgcaaggtcgtagctggaaatatatctccaaatggatggtgcgtggcctttgtaccaaagtcagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z