BBa_K2055009 1 BBa_K2055009 FUR Protein 2016-09-27T11:00:00Z 2016-09-28T04:06:55Z The sequence for the FUR Box was obtained from the results of the paper of Quatrini et al. (Citation in our wiki). Ferric Uptace Regulator Protein codon-optimized for Acidithiobacillus Ferrooxidans, the FUR Protein in presence of iron will block the transcription because it will bind to its FUR Box. false false _2523_ 30725 30725 9 false You will have to add a FUR Box to repress the transcription with this FUR protein in presence of iron. false Carlos Vasquez BBa_K2055009_sequence 1 atgattgatgagaggatgaactcggacgaactgaaacgggctggtctcaaggccaccctcccacgactcaagatcctacggatattcgaagattcggatgctcgacatctgaccgcaggtgagatctatcggctcttgctggaaaccggcgaagaagtgggcttggcgaccgtatatcgtgtactgacgcagttcgagatggcaggtttggtccgccgccatcattttgagggcgataaggccgtgttcgagctgaacgagaccggtcaccacgaccacatggtgtgtactgcgtgtggaaaggtgctcgagtttttcgacgaaatgctggaagcccggcaacgcgagctcgccgccaatcgcggtttcttcatttcggatcatagtctctatctttatggcacctgtctgggcatgcaggacgtgggaatctgctcgcttcgcgacgacgacgcgccaggtgccagtactgactgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z