BBa_K2055013 1 BBa_K2055013 Heat Shock Promoter 2016-09-27T11:00:00Z 2016-09-28T04:19:49Z Ribeiro, D. A., Del Bem, L. E., Vicentini, R., Ferraz, L. F., Murakami, M. T., & Ottoboni, L. M. (2011). The small heat shock proteins from Acidithiobacillus ferrooxidans: gene expression, phylogenetic analysis, and structural modeling. BMC microbiology, 11(1), 1. σ32-dependent promoter for for the Afe_1437 gene in Acidithiobacillus ferrooxidans false false _2523_ 30725 30725 9 false Putative promoter in Acidithiobacillus ferrooxidans. Must check its characterization. false Raul Garza BBa_K2055013_sequence 1 actcgtacccataacgttgcatgccagagtccaggcgtacagtcgcttggctggcgtcctattgatgcccgtgaaggaggtgtaaaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z