BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2001 1 lac O1 range2001 1 26 42 annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2000 1 -35 range2000 1 20 25 BBa_K2055007 1 BBa_K2055007 LacI for Acidithiobacillus 2016-09-27T11:00:00Z 2016-09-28T06:11:09Z The RBS used is the BBa_B0034, the terminator is the BBA_B0012, the LacI reculated Promoter is the BBa_R0011. The sequence for the FUR Box was obtained from the results of the paper of Quatrini et al. (Citation in our wiki), choosing the Fur box with the best score. The sequence for the FUR protein was obtained from the Acidithiobacillus ferrooxidans genome. Inverter with Ferric Uptake Regulator & LacI. Activates gene expression in presence of iron. LacI and FUR proteins are optimized for Acidithiobacillus ferrooxidans. false false _2523_ 30725 30725 9 false It does not have a promoter. false Carmen Padilla, Melissa Gonzalez & Melissa Rios BBa_K2055014 1 BBa_K2055014 Inverter with Ferric Uptake Regulator & LacI. Activates gene expression in presence of iron. 2016-09-27T11:00:00Z 2016-09-28T05:15:41Z Composite part. Inverter with Ferric Uptake Regulator & LacI. Activates gene expression in presence of iron. LacI and FUR proteins are optimized for Acidithiobacillus ferrooxidans. false false _2523_ 30725 30725 9 false It does not has a promoter. false Raul Garza & Carlos Vasquez component2485263 1 BBa_R0011 component2485258 1 BBa_K2055007 component2485259 1 BBa_B0012 component2485254 1 BBa_K2055009 component2485253 1 BBa_B0034 component2485257 1 BBa_B0034 component2485255 1 BBa_K2055010 annotation2485257 1 BBa_B0034 range2485257 1 534 545 annotation2485255 1 BBa_K2055010 range2485255 1 507 525 annotation2485254 1 BBa_K2055009 range2485254 1 19 498 annotation2485258 1 BBa_K2055007 range2485258 1 552 1637 annotation2485263 1 BBa_R0011 range2485263 1 1695 1748 annotation2485253 1 BBa_B0034 range2485253 1 1 12 annotation2485259 1 BBa_B0012 range2485259 1 1646 1686 BBa_K2055010 1 BBa_K2055010 FUR Box 2016-09-27T11:00:00Z 2016-09-28T04:07:16Z It is the FUR Box with the highest score in the work of: Quatrini, R., Lefimil, C., Veloso, F. A., Pedroso, I., Holmes, D. S., & Jedlicki, E. (2007). Bioinformatic prediction and experimental verification of Fur-regulated genes in the extreme acidophile Acidithiobacillus ferrooxidans. Nucleic Acids Research, 35(7), 2153???2166. http://doi.org/10.1093/nar/gkm068 This is a FUR Box with high affinity to BBa_K2055009. In presence of iron, it will block the downstream transcription. false false _2523_ 30725 30725 9 false It needs iron to block transcription. false Carlos Vasquez BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K2055009 1 BBa_K2055009 FUR Protein 2016-09-27T11:00:00Z 2016-09-28T04:06:55Z The sequence for the FUR Box was obtained from the results of the paper of Quatrini et al. (Citation in our wiki). Ferric Uptace Regulator Protein codon-optimized for Acidithiobacillus Ferrooxidans, the FUR Protein in presence of iron will block the transcription because it will bind to its FUR Box. false false _2523_ 30725 30725 9 false You will have to add a FUR Box to repress the transcription with this FUR protein in presence of iron. false Carlos Vasquez BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K2055007_sequence 1 atgaaacccgtaacgctctacgatgtggcggaatacgctggcgtgtcttaccagaccgtcagcagggttgtgaatcaagcctcccatgtatcggcgaaaacccgtgagaaagtggaggcggcaatggctgaactgaactatatcccaaaccgagttgctcaacagctcgcaggcaaacagagtctcctcattggcgtcgccacgtcctcgttggctctgcatgccccgagccagattgtggcggcgatcaagtcccgcgccgaccagcttggagcgtcggtggttgtctctatggtggaacggtcaggcgttgaggcgtgcaaggctgcggtacataacctgctggcccagcgagtaagcggcctcattattaactaccctctggacgatcaggacgctatcgctgtcgaggccgcatgtacaaacgtccccgccctgttcctcgacgtctcggatcagacgcccatcaacagtataattttttctcatgaagacggcacccggttaggcgttgagcatctggtagccttgggccaccagcagattgccctcctggcaggccctctttcgagtgtaagcgcccgcttgcgccttgcaggctggcataagtatcttacccgaaaccagatccagccgatcgcggaacgcgagggagattggtccgccatgtcaggatttcaacagacgatgcaaatgctcaacgaaggtatcgtaccgacggccatgttggtcgcgaacgaccaaatggccctgggcgcgatgcgggcgataacggaaagcggcctacgcgtcggagccgacatctcagtggtcggctacgacgatacggaagactcctcctgctatattccccccctcacgaccattaagcaggactttcgcctgttgggacaaacgtccgttgatcgactccttcagctgtcgcagggtcaagccgtgaaaggaaatcagctcctgcctgtcagtctggtgaaacgcaagaccaccttggcccccaatacccaaaccgccagcccccgcgcgcttgcggattctctcatgcagttggctagacaggttagtcgcctggaatcgggacagtgataa BBa_K2055014_sequence 1 aaagaggagaaatactagatgattgatgagaggatgaactcggacgaactgaaacgggctggtctcaaggccaccctcccacgactcaagatcctacggatattcgaagattcggatgctcgacatctgaccgcaggtgagatctatcggctcttgctggaaaccggcgaagaagtgggcttggcgaccgtatatcgtgtactgacgcagttcgagatggcaggtttggtccgccgccatcattttgagggcgataaggccgtgttcgagctgaacgagaccggtcaccacgaccacatggtgtgtactgcgtgtggaaaggtgctcgagtttttcgacgaaatgctggaagcccggcaacgcgagctcgccgccaatcgcggtttcttcatttcggatcatagtctctatctttatggcacctgtctgggcatgcaggacgtgggaatctgctcgcttcgcgacgacgacgcgccaggtgccagtactgactgataatactagagtgtaataagactcattcgttactagagaaagaggagaaatactagatgaaacccgtaacgctctacgatgtggcggaatacgctggcgtgtcttaccagaccgtcagcagggttgtgaatcaagcctcccatgtatcggcgaaaacccgtgagaaagtggaggcggcaatggctgaactgaactatatcccaaaccgagttgctcaacagctcgcaggcaaacagagtctcctcattggcgtcgccacgtcctcgttggctctgcatgccccgagccagattgtggcggcgatcaagtcccgcgccgaccagcttggagcgtcggtggttgtctctatggtggaacggtcaggcgttgaggcgtgcaaggctgcggtacataacctgctggcccagcgagtaagcggcctcattattaactaccctctggacgatcaggacgctatcgctgtcgaggccgcatgtacaaacgtccccgccctgttcctcgacgtctcggatcagacgcccatcaacagtataattttttctcatgaagacggcacccggttaggcgttgagcatctggtagccttgggccaccagcagattgccctcctggcaggccctctttcgagtgtaagcgcccgcttgcgccttgcaggctggcataagtatcttacccgaaaccagatccagccgatcgcggaacgcgagggagattggtccgccatgtcaggatttcaacagacgatgcaaatgctcaacgaaggtatcgtaccgacggccatgttggtcgcgaacgaccaaatggccctgggcgcgatgcgggcgataacggaaagcggcctacgcgtcggagccgacatctcagtggtcggctacgacgatacggaagactcctcctgctatattccccccctcacgaccattaagcaggactttcgcctgttgggacaaacgtccgttgatcgactccttcagctgtcgcagggtcaagccgtgaaaggaaatcagctcctgcctgtcagtctggtgaaacgcaagaccaccttggcccccaatacccaaaccgccagcccccgcgcgcttgcggattctctcatgcagttggctagacaggttagtcgcctggaatcgggacagtgataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca BBa_B0034_sequence 1 aaagaggagaaa BBa_K2055010_sequence 1 tgtaataagactcattcgt BBa_K2055009_sequence 1 atgattgatgagaggatgaactcggacgaactgaaacgggctggtctcaaggccaccctcccacgactcaagatcctacggatattcgaagattcggatgctcgacatctgaccgcaggtgagatctatcggctcttgctggaaaccggcgaagaagtgggcttggcgaccgtatatcgtgtactgacgcagttcgagatggcaggtttggtccgccgccatcattttgagggcgataaggccgtgttcgagctgaacgagaccggtcaccacgaccacatggtgtgtactgcgtgtggaaaggtgctcgagtttttcgacgaaatgctggaagcccggcaacgcgagctcgccgccaatcgcggtttcttcatttcggatcatagtctctatctttatggcacctgtctgggcatgcaggacgtgggaatctgctcgcttcgcgacgacgacgcgccaggtgccagtactgactgataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z