BBa_K2055001 1 BBa_K2055001 Na(+)/H(+) antiporter NhaA 2016-09-28T11:00:00Z 2016-10-12T09:46:35Z The sequence was obtained from Uniprot P13738. The origin for this sequence is E. Coli. This construct codes for intermembrane protein Na(+)/H(+) antiporter NhaA, which is a proton pump from E. coli capable of excreting one Na(+) ion in exchange for two H(+) external protons. This protein is active at alkaline pH. This construct is regulated by a weak constitutive promoter and its objective is to augment bacterial resistance to alkaline pH. false false _2523_ 30722 30723 9 false The coding sequence is optimized for its expression in C. violaceum and could be tested as a potential selective marker for C. violaceum. This construct is regulated by a weak constitutive promoter and its objective is to augment bacterial resistance to alkaline pH. false Suria Itzel Morales Guzm??n BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939303 1 BBa_B0012 component939311 1 BBa_B0011 annotation939311 1 BBa_B0011 range939311 1 50 95 annotation939303 1 BBa_B0012 range939303 1 1 41 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K2055369 1 BBa_K2055369 Na(+)/H(+) antiporter NhaA generator 2016-10-11T11:00:00Z 2016-10-12T09:58:23Z The sequence was obtained from Uniprot P13738. The origin for this sequence is E. Coli. This construct codes for intermembrane protein Na(+)/H(+) antiporter NhaA, which is a proton pump from E. coli capable of excreting one intracellular Na(+) ion in exchange for two H(+) external protons. This protein is active at alkaline pH. This construct is regulated by weak constitutive promoter and its objective is to augment bacterial resistance to alkaline pH. false false _2523_ 30722 30722 9 false The coding sequence is optimized for its expression in C. violaceum and could be tested as a potential selective marker for C. violaceum. This construct is regulated by a weak constitutive promoter and its objective is to augment bacterial resistance to alkaline pH. false Suria Itzel Morales Guzm??n component2495915 1 BBa_K2055001 component2495912 1 BBa_J23114 component2495922 1 BBa_B0014 component2495914 1 BBa_B0034 annotation2495912 1 BBa_J23114 range2495912 1 1 35 annotation2495915 1 BBa_K2055001 range2495915 1 62 1231 annotation2495922 1 BBa_B0014 range2495922 1 1240 1334 annotation2495914 1 BBa_B0034 range2495914 1 44 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23114 1 BBa_J23114 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23114_sequence 1 tttatggctagctcagtcctaggtacaatgctagc BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0034_sequence 1 aaagaggagaaa BBa_K2055369_sequence 1 tttatggctagctcagtcctaggtacaatgctagctactagagaaagaggagaaatactagatgaaacatctgcatcgcttttttagcagcgatgcgagcggcggcattattctgattattgcggcgattctggcgatgattatggcgaacagcggcgcgaccagcggctggtatcatgattttctggaaaccccggtgcagctgcgcgtgggcagcctggaaattaacaaaaacatgctgctgtggattaacgatgcgctgatggcggtgttttttctgctggtgggcctggaagtgaaacgcgaactgatgcagggcagcctggcgagcctgcgccaggcggcgtttccggtgattgcggcgattggcggcatgattgtgccggcgctgctgtatctggcgtttaactatgcggatccgattacccgcgaaggctgggcgattccggcggcgaccgatattgcgtttgcgctgggcgtgctggcgctgctgggcagccgcgtgccgctggcgctgaaaatttttctgatggcgctggcgattattgatgatctgggcgcgattattattattgcgctgttttataccaacgatctgagcatggcgagcctgggcgtggcggcggtggcgattgcggtgctggcggtgctgaacctgtgcggcgcgcgccgcaccggcgtgtatattctggtgggcgtggtgctgtggaccgcggtgctgaaaagcggcgtgcatgcgaccctggcgggcgtgattgtgggcttttttattccgctgaaagaaaaacatggccgcagcccggcgaaacgcctggaacatgtgctgcatccgtgggtggcgtatctgattctgccgctgtttgcgtttgcgaacgcgggcgtgagcctgcaaggcgtgaccctggatggcctgaccagcattctgccgctgggcattattgcgggcctgctgattggcaaaccgctgggcattagcctgttttgctggctggcgctgcgcctgaaactggcgcatctgccggaaggcaccacctatcagcagattatggtggtgggcattctgtgcggcattggctttaccatgagcatttttattgcgagcctggcgtttggcagcgtggatccggaactgattaactgggcgaaactgggcattctggtgggcagcattagcagcgcggtgattggctatagctggctgcgcgtgcgcctgcgcccgagcgtgtaataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_K2055001_sequence 1 atgaaacatctgcatcgcttttttagcagcgatgcgagcggcggcattattctgattattgcggcgattctggcgatgattatggcgaacagcggcgcgaccagcggctggtatcatgattttctggaaaccccggtgcagctgcgcgtgggcagcctggaaattaacaaaaacatgctgctgtggattaacgatgcgctgatggcggtgttttttctgctggtgggcctggaagtgaaacgcgaactgatgcagggcagcctggcgagcctgcgccaggcggcgtttccggtgattgcggcgattggcggcatgattgtgccggcgctgctgtatctggcgtttaactatgcggatccgattacccgcgaaggctgggcgattccggcggcgaccgatattgcgtttgcgctgggcgtgctggcgctgctgggcagccgcgtgccgctggcgctgaaaatttttctgatggcgctggcgattattgatgatctgggcgcgattattattattgcgctgttttataccaacgatctgagcatggcgagcctgggcgtggcggcggtggcgattgcggtgctggcggtgctgaacctgtgcggcgcgcgccgcaccggcgtgtatattctggtgggcgtggtgctgtggaccgcggtgctgaaaagcggcgtgcatgcgaccctggcgggcgtgattgtgggcttttttattccgctgaaagaaaaacatggccgcagcccggcgaaacgcctggaacatgtgctgcatccgtgggtggcgtatctgattctgccgctgtttgcgtttgcgaacgcgggcgtgagcctgcaaggcgtgaccctggatggcctgaccagcattctgccgctgggcattattgcgggcctgctgattggcaaaccgctgggcattagcctgttttgctggctggcgctgcgcctgaaactggcgcatctgccggaaggcaccacctatcagcagattatggtggtgggcattctgtgcggcattggctttaccatgagcatttttattgcgagcctggcgtttggcagcgtggatccggaactgattaactgggcgaaactgggcattctggtgggcagcattagcagcgcggtgattggctatagctggctgcgcgtgcgcctgcgcccgagcgtgtaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z