BBa_K2056001 1 BBa_K2056001 NsrR - NO(x) sensitive pYear, pNirk repressor protein 2016-10-12T11:00:00Z 2016-10-13T10:04:47Z This part has been designed after the part Bba_K1682011 in the Registry of Standard Biological Parts. This part contains the NsrR (NO(x) sensitive pYear, pNirk repressor protein) encoding region. Escherichia coli (E. coli) detects environmental nitrate by the yeaR-yoaG operon. PyeaR is regulated by the NsrR repressor protein. Nitric oxide binds to the NsrR protein and relieves the repression on PyeaR. As a result, any genes that are downstream of PyeaR are expressed. This part is also related with BBa_K2056002, the promoter region of the NirK protein, because NsrR activates the transcription of NirK under high nitrite conditions. Due to these properties, we can use this part as a sensor for oxides of nitrogen. false false _2524_ 33019 33019 9 false Because the part Bba_K1682011 was not available from the registry, we had to get it synthesized. We had to codon optimized this part to conform to assembly standards and the requirements for synthesis. false Muhammad Ismail BBa_K2056001_sequence 1 gtgcagttaacgagtttcactgattacggattacgtgcgctgatctacatggcgtcattgccagaagggcggatgaccagtatttctgaagtgactgacgtctacggcgtctcccgtaatcatatggtcaaaataatcaatcaacttagtcgtgccggctacgtgactgctgttcgtggaaaaaatggcggcattcgcctgggtaaaccggcgagtgcgatacgtattggtgatgtggtgcgcgagctggagcccttatcgctggtgaattgcagcagtgagttttgccacattacacctgcctgtaggttgaaacaggcactttctaaggccgtgcaaagttttcttacggaactggataactacacgcttgccgatttggttgaagagaatcaaccgctttataaattattgctggtggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z