BBa_K2057000 1 BBa_K2057000 Promoter chiA74 from Bacillus thuringiensis 2016-10-13T11:00:00Z 2016-10-20T10:14:33Z Promoter chiA74 is found on the chromosome of a mexican strain of Bacillus thuringiensis subsp. kenyae (Gen bank accession number AF424979) The promoter chiA74 control the expression of the endochitinase chiA74 from a strain of Bacillus thuringiensis. In spite of is derived from a gene of a Gram positive bacterium, it is funcional in a Gram negative bacteria, and control the expression of the same gene in Escherichia coli in a constitutive form. This promoter can be to control the expression constitutively of a gene in E. coli. false false _2525_ 21127 21127 9 false The only modification was that we included two artificial restriction sites in the in the 5??and 3??terminus, so that we could clone it in a vector. false Uriel Eleazar Barboza P??rez annotation2525733 1 -10 promoter range2525733 1 399 404 annotation2525732 1 -35 promoter range2525732 1 379 384 BBa_K2057000_sequence 1 tttaatatatctttttgtagttccatttctggtggaatcattcccgcattttttaaaattttataactcattctaagttctggaggtaccattgaaagatcttctaattgtagtggttttccttttcccggaagataatcaagatcaccattccgtattgcttgtcgaattttttcttcagcaatgttcaaaaacacatccacactacttccctccttgacatatttttactattatttcacatgatatttccttatctttctacgtctttaataattggctccatacaattttttctcaaatttatttataatgagctatttcctcccataccaatctttcgttttcatatatagtttgtattcaagcctttttgtattgagaaagtctttttcaacttaataaagcgtttacactaatcttacatttgttacgatttaatcacccccagctcccttgtatagacttcgtgatgtctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z