BBa_K2057001 1 BBa_K2057001 Promoter BtI-BtII 2016-10-13T11:00:00Z 2016-10-21T12:09:31Z Promoter Bti-BtII of the cry1Ac gene is found on a megaplasmid of Bacillus thuringiensis subsp. kurstaki HD73 This is a dual strong promoter that control the expression of Cry1Ac proteins in Bacillus thuringiensis, but it is expressed constitutively in Escherichia coli. This promoter can control the expression of genes that need to be expressed in a constitutive way in E. coli. false false _2525_ 30590 21127 9 false We amplified the promoter from the cry1Ac gene and include restriction sites not found inside the sequence but compatible with the prefix and suffix of the pSB1C3 false Uriel Eleazar Barboza P??rez annotation2513451 1 BtII (-10) range2513451 1 294 302 annotation2513450 1 BtI (-35) range2513450 1 285 291 annotation2513452 1 BtI (-10) range2513452 1 306 313 annotation2513453 1 RBS range2513453 1 377 381 BBa_K2057001_sequence 1 ttacaattcaagatgaattgcaggtaaatggttctaacatgtataagtgtaagtatttctacattaccacaaattctcaatttgtatatgtaaaataggaaaagtggattttatatataagtataaaaagtaataagactttaaaataagttaacggaatacaaacccttaatgcattggttaaacattgtaaagtctaaagcatggataatgggcgagaagtaagtagattgttaacaccctgggtcaaaaattgatatttagtaaaattagttgcactttgtgcattttttcataagatgagtcatatgttttaaattgtagtaatgaaaaacagtattatatcataatgaattggtatcttaataaaagagatggaggtaactt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z