BBa_K206000 1 pBAD pBAD strong 2009-10-13T11:00:00Z 2015-05-08T01:11:23Z The sequence was obtained by applying all mutations that upregulated AraC binding and subsequent promoter activity listed in reference [1]. Released HQ 2013 pBAD is an <i>E.coli</i> promoter that is induced by L-arabinose. K206000 is a mutagenized pBAD promoter that is responsive to lower concentrations of arabinose than wild type (<partinfo>I13453</partinfo>) and, additionally, exhibits a higher maximum of protein expression as measured by coupling to a fluorescent reporter. false false _307_ 0 4172 9 In stock true There were no special design considerations. false Amelia Hardjasa annotation2049254 1 AraI2 range2049254 1 61 78 annotation2049252 1 promoter range2049252 1 1 131 annotation2049253 1 AraI1 range2049253 1 40 57 BBa_K206000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z