BBa_K2060000 1 BBa_K2060000 CRISPR-Cas9 guide RNA targeting to 16S RNA 2016-09-22T11:00:00Z 2016-09-30T06:06:30Z E.coli 16S ribosomal RNA This part includes a guide RNA that will target Cas9 to the E.Coli 16S ribosomal RNA locus. The guide RNA is expressed with the Cas9-recognised RNA scaffold. Expression of the guideRNA is driven by the T7 promotor with Lac0 binding site and followed by a T7 terminator sequence. false false _2528_ 30664 30664 9 false Used standard design considerations for guide RNAs false Cardiff_Wales Team, Geraint Parry annotation2484565 1 guideRNA range2484565 1 51 53 annotation2484553 1 KpnI range2484553 1 45 50 annotation2484555 1 T7term range2484555 1 153 188 annotation2484554 1 guideRNA range2484554 1 51 152 annotation2484552 1 LacO range2484552 1 20 44 annotation2484551 1 T7 range2484551 1 1 17 BBa_K2060000_sequence 1 taatacgactcactataggggaattgtgagcggataacaattccggtaccggtggggtaacggctcaccagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttctagcataaccccttggggcctctaaacgggtcttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z