BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K206005 1 BBa_K206005 GFP generator for testing pBAD strong 2009-10-18T11:00:00Z 2015-05-08T01:11:24Z Assembled from Registry BioBricks. Released HQ 2013 This is a construct for testing promoter strength by measuring GFP fluorescence. false true _307_ 0 4172 9 In stock true No special design considerations. false Amelia Hardjasa component2054333 1 BBa_K206000 component2054335 1 BBa_B0034 component2054340 1 BBa_J04031 component2054341 1 BBa_B0010 component2054343 1 BBa_B0012 annotation2054341 1 BBa_B0010 range2054341 1 924 1003 annotation2054343 1 BBa_B0012 range2054343 1 1012 1052 annotation2054340 1 BBa_J04031 range2054340 1 157 915 annotation2054335 1 BBa_B0034 range2054335 1 139 150 annotation2054333 1 BBa_K206000 range2054333 1 1 130 BBa_K206000 1 pBAD pBAD strong 2009-10-13T11:00:00Z 2015-05-08T01:11:23Z The sequence was obtained by applying all mutations that upregulated AraC binding and subsequent promoter activity listed in reference [1]. Released HQ 2013 pBAD is an <i>E.coli</i> promoter that is induced by L-arabinose. K206000 is a mutagenized pBAD promoter that is responsive to lower concentrations of arabinose than wild type (<partinfo>I13453</partinfo>) and, additionally, exhibits a higher maximum of protein expression as measured by coupling to a fluorescent reporter. false false _307_ 0 4172 9 In stock true There were no special design considerations. false Amelia Hardjasa annotation2049254 1 AraI2 range2049254 1 61 78 annotation2049252 1 promoter range2049252 1 1 131 annotation2049253 1 AraI1 range2049253 1 40 57 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J04031 1 BBa_J04031 GFP w/LVA tag 2005-06-07T11:00:00Z 2015-08-31T04:08:13Z Davidson Synth Aces BBa_E0040 with an LVA tag added via PCR. BBa_E0040 is GFP(mut3b). false true _16_ 0 326 16 It's complicated false false Kristen DeCelle annotation1507235 1 LVA range1507235 1 715 753 annotation1507246 1 Start range1507246 1 1 3 annotation1507242 1 Double Stop range1507242 1 754 759 annotation1507202 1 BBa_E0040 range1507202 1 1 720 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K206000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K206005_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J04031_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z