BBa_K206013 1 BBa_K206013 lox reverse 2009-10-18T11:00:00Z 2015-05-08T01:11:24Z The part was ordered from Integrated DNA Technologies. This is the sequence for a reverse lox recombination site used in the Cre/lox recombination system. false false _307_ 0 3958 9 It's complicated true We inverted the lox sequence (BBa_J61046) to create this part. false Eric Ma BBa_K206013_sequence 1 ataacttcgtatagcatacattatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z