BBa_K206030 1 BBa_K206030 Lock 1 2009-05-10T11:00:00Z 2015-05-08T01:11:24Z Taken from Isaacs et al., with modifications to remove an extra EcoRI site. crR12-loop-RBS sequence taken from Isaacs et al. (1), with modifications to remove an extra EcoRI site. crR12 binds to the RBS, preventing translation of the mRNA unless a matching "key" RNA is also present in the cell. 1) Isaacs, FJ, Dwyer, DJ, Ding, C, Pervouchine, DD, Cantor, CR, and Collins, JJ. Engineered riboregulators enable post-transcriptional control of gene expression. 2004. Nature Biotechnology 22(7):841-847. false false _307_ 0 4172 9 Not in stock false Sequence provided in the supplementary table of Isaacs paper is lacking 5 bases present in the diagram that appear to contribute to secondary structure folding. These bases were included in the sequence, with one A->T change to avoid the inclusion of an EcoRI site. false Amelia Hardjasa and Alex Ng annotation2004378 1 crR12 range2004378 1 7 25 annotation2004379 1 loop range2004379 1 26 31 annotation2004380 1 rbs range2004380 1 37 44 BBa_K206030_sequence 1 aagcgcagtaattcacctcttggatttgggtatcaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z