BBa_K206031 1 BBa_K206031 Key 1 2009-06-05T11:00:00Z 2015-05-08T01:11:24Z 1) Isaacs, FJ, Dwyer, DJ, Ding, C, Pervouchine, DD, Cantor, CR, and Collins, JJ. Engineered riboregulators enable post-transcriptional control of gene expression. 2004. Nature Biotechnology 22(7):841-847. A standardized BioBrick part of "Key 1" from Issacs' taR12 sequence (1). This part "unlocks" the "Lock 1" crR12 sequence (See Part:BBa_K206001). To activate a lock, assemble a promoter immediately upstream of the coding strand of this part. [New and experimental:] To deactivate this key, assemble a reverse promoter immediately downstream of the non-coding strand of this part. false false _307_ 0 3909 9 Not in stock false taR12 sequence from Isaacs et al. (1) with the following modifications: a. removal of last 6 nucleotides from the 3' end, to reduce probability of unwanted binding from complimentary scars b. changing of nucleotide 13 from G to U, to allow complementarity with the suffix scar to block an exposed rbs false Alex Ng annotation2004377 1 YUNR recognition range2004377 1 3 6 annotation2004376 1 Loop range2004376 1 38 41 BBa_K206031_sequence 1 acccaaatccagtaggtgattggtagtggtggttaatgaaaattaacttactactaccatatatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z