BBa_K2061003 1 BBa_K2061003 gRNA2 for editing F508 deletion 2016-08-22T11:00:00Z 2016-10-10T04:39:37Z synthetic production of the part This plasmid contains the sequence coding for the second gRNA for editing the CFTR F508 deletion under U6 promoter. The part was cloned into the pSB1C3 plasmid with chloramphenicol rresistance. false false _2529_ 31098 31098 9 false the part cloned between EcoRI and PstI sites. false avi matityahu annotation2481549 1 PAM range2481549 1 346 348 annotation2481546 1 EcorI site range2481546 1 1 6 annotation2481550 1 gRNA scaffold seq range2481550 1 349 425 annotation2481547 1 U6 range2481547 1 7 324 annotation2481551 1 PstI site range2481551 1 466 471 annotation2481548 1 Ex11 gRNA2 range2481548 1 326 345 BBa_K2061003_sequence 1 gaattctgtacaaaaaagcaggctttaaaggaaccaattcagtcgactggatccggtaccaaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgcaaagcatgccaactagaagagggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttctagacccagctttcttgtacaaagttggcattactgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z