BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_K206108 1 BBa_K206108 421 2010-03-29T11:00:00Z 2015-05-08T01:11:24Z ? ? false false _307_ 0 4172 9 Not in stock false ? false Amelia Hardjasa component2247090 1 BBa_E0035 component2247074 1 BBa_J23100 component2247076 1 BBa_B0030 annotation2247076 1 BBa_B0030 range2247076 1 44 58 annotation2247090 1 BBa_E0035 range2247090 1 65 443 annotation2247074 1 BBa_J23100 range2247074 1 1 35 BBa_E0035 1 BBa_E0035 LacZ alpha fragment; complements matching N-terminal deletion mutant (lacZ-omega) 2007-12-21T12:00:00Z 2015-08-31T04:07:25Z This part is derived from BBa_E0033. This part encodes the alpha fragment of the lacZ gene. To greatly reduce the number of bases, this is only a portion of the LacZ gene. It can be used as a detection system with N-terminal deletion mutants of lacZ. Combination of lacZ-alpha with such a deletion mutant protein restores enzyme activity that can be assayed colorimetrically or more sensitively with chemiluminescent substrates. false false _41_ 0 126 162 Not in stock false It has the additional T needed to ensure that the double stop codon is in frame. false Reshma Shetty annotation1959037 1 T3 promoter range1959037 1 26 35 annotation1959042 1 C range1959042 1 108 108 annotation1959039 1 C range1959039 1 78 78 annotation1959040 1 T range1959040 1 81 81 annotation1959045 1 inserted T range1959045 1 348 348 annotation1959035 1 lacZ gene fragment range1959035 1 1 15 annotation1959038 1 T7 promoter range1959038 1 173 191 annotation1959036 1 lacZ alpha range1959036 1 1 354 annotation1959041 1 A range1959041 1 87 87 annotation1959046 1 barcode range1959046 1 355 379 annotation1959043 1 G range1959043 1 111 111 annotation1959044 1 lacZ gene fragment range1959044 1 199 348 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K206108_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagatgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcagcactagagctagtggatcccccgggctgtagaaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaattaataacgctgatagtgctagtgtagatcgc BBa_B0030_sequence 1 attaaagaggagaaa BBa_E0035_sequence 1 atgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcagcactagagctagtggatcccccgggctgtagaaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaattaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z