BBa_K2064002 1 BBa_K2064002 TyrB Acceptor and Donor COM 2016-10-20T11:00:00Z 2016-10-28T08:42:22Z Synthetic, codon optimized for E. coli We developed a BioBrick that is used to link the inserted protein with a protein containing a Tyrocidine B donor domain as well as a Tyrocidine C acceptor domain. This allows the two proteins to come together in physical space through protein-protein interactions and increase the efficiency of enzymatic gene clusters. It is under the control of an inducible T7 promoter and terminator pair from a pET-16b vector allowing expression of protein. It contains a golden gate cloning site for the scarless insertion of NRPS modules or other proteins false false _2532_ 27296 27296 9 false Xba1 cut site removed, originally located downstream of the promoter false Dragos S. Chiriac BBa_K2064002_sequence 1 cgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatcgagatctcgatcccgcgaaattaatacgactcactataggggaattgtgagcggataacaattcccctcttgatataattttgtttaactttaagaaggagatatagcatgagcgttttctccaaggaacaggtccaggatatgtacgctttaacgcctgagaccgctggcacgacagttggtctccccagtgacttaggagacgaggagttgagtatggaagagctggagaacattcttgagtggatctaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z