BBa_K2066001 1 BBa_K2066001 UNS Standard Adapter with Red Chromoprotein. 2016-07-11T11:00:00Z 2016-10-12T11:59:59Z The UNS2 and UNS3 sequences are taken from: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. Other sequences are from the iGEM registry. This part serves as an adapter to the UNS standard adopted by the WM iGEM 2016 team. The part expresses a red chromoprotein as an indicator molecule and teams can perform PCR to amplify the backbone using a UNS 2 reverse and UNS 3 forward primer. This will allow you to go into a gibson assembly with another fragment containing USN 2 and 3 at either end. The UNS2 and UNS3 sequences are taken from: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. false false _2534_ 27446 27446 9 false We wanted to maintain a standard that allowed us an easy and consistent way to PCR and gibson clone our samples, which we did not find in the Prefix and Suffix. PCRs and Gibson assemblies using USN 2 and 3 primers have been very effective. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss component2494433 1 BBa_K2066019 component2494423 1 BBa_B0034 component2494420 1 BBa_K2066018 component2494432 1 BBa_B0015 component2494425 1 BBa_K592012 component2494421 1 BBa_J23110 annotation2494420 1 BBa_K2066018 range2494420 1 1 40 annotation2494433 1 BBa_K2066019 range2494433 1 898 937 annotation2494425 1 BBa_K592012 range2494425 1 88 768 annotation2494423 1 BBa_B0034 range2494423 1 76 87 annotation2494432 1 BBa_B0015 range2494432 1 769 897 annotation2494421 1 BBa_J23110 range2494421 1 41 75 BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23110 1 BBa_J23110 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K2066019 1 BBa_K2066019 UNS 3 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:43:00Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 3, (UNS 3), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false This UNS sequence was chosen to serve as the 3' primer in our standard because it works well with UNS 2 and it adheres to the BioBrick standards. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K592012 1 eforRed eforRed, red chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:49Z coming soon This chromoprotein eforRed naturally exhibits red color when expressed. The color is weaker than RFP, however. On agar plates and in liquid culture, the color is readily visible to naked eye in less than 24 hours of incubation. The DNA was codon-optimized for expression in E.coli and synthesized by the Korean company Bioneer Corporation. false false _763_ 0 7929 9 It's complicated false coming soon false Lei Sun annotation2131799 1 eforRed range2131799 1 1 681 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2066019_sequence 1 gcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_B0034_sequence 1 aaagaggagaaa BBa_K592012_sequence 1 atgtcagtgattaagcaggtaatgaagaccaagttgcaccttgagggcactgtcaatggccatgattttacgatcgagggtaaaggtgaaggcaagccgtacgaagggttacagcacatgaaaatgacagtcaccaaaggcgcgcctctgccgttttccgttcatattcttacacctagccacatgtatggaagcaaaccgtttaataagtatccagcggatatcccagactaccacaaacagtcttttcccgaaggtatgtcttgggagcggtcgatgatttttgaagatggtggcgtatgcaccgccagtaatcactccagcataaacttgcaagagaactgtttcatctatgatgttaaatttcatggtgtgaacctgcctccggatgggcccgtaatgcaaaaaaccattgctggatgggagccgagcgtggaaacactgtacgtgcgtgacgggatgttaaaaagtgacactgcaatggtttttaaactgaaaggaggcggtcatcatcgtgttgatttcaaaacgacgtataaagccaaaaaacctgtcaagctgccagaatttcatttcgttgaacatcgcctggaactgaccaaacacgataaagatttcacaacttgggaccagcaggaggcagccgaaggccatttctcaccgctgccgaaggctctccca BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_J23110_sequence 1 tttacggctagctcagtcctaggtacaatgctagc BBa_K2066001_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagctttacggctagctcagtcctaggtacaatgctagcaaagaggagaaaatgtcagtgattaagcaggtaatgaagaccaagttgcaccttgagggcactgtcaatggccatgattttacgatcgagggtaaaggtgaaggcaagccgtacgaagggttacagcacatgaaaatgacagtcaccaaaggcgcgcctctgccgttttccgttcatattcttacacctagccacatgtatggaagcaaaccgtttaataagtatccagcggatatcccagactaccacaaacagtcttttcccgaaggtatgtcttgggagcggtcgatgatttttgaagatggtggcgtatgcaccgccagtaatcactccagcataaacttgcaagagaactgtttcatctatgatgttaaatttcatggtgtgaacctgcctccggatgggcccgtaatgcaaaaaaccattgctggatgggagccgagcgtggaaacactgtacgtgcgtgacgggatgttaaaaagtgacactgcaatggtttttaaactgaaaggaggcggtcatcatcgtgttgatttcaaaacgacgtataaagccaaaaaacctgtcaagctgccagaatttcatttcgttgaacatcgcctggaactgaccaaacacgataaagatttcacaacttgggaccagcaggaggcagccgaaggccatttctcaccgctgccgaaggctctcccaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z