BBa_K2066501 1 BBa_K2066501 ICA:BsmBI Cut Site + G + Sticky End 1 2016-08-24T11:00:00Z 2016-08-25T07:32:44Z This part was synthesized as part of a gBlock / using IDT DNA synthesis. Part sequence based off of supplemental material from Briggs et al., 2012. This is an intermediate part used in the construction of WM16_002. This part contains the BsmBI cut site followed by a single nucleotide spacer (G) followed by sticky end 1. Sticky end 1 is one of three sticky ends used by WM iGEM 2016 for Iterative Capped Assembly. ICA design method based off of Briggs, A. W., Rios, X., Chari, R., Yang, L., Zhang, F., Mali, P., & Church, G. M. (2012). Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. Nucleic acids research, gks624. false false _2534_ 27446 27446 9 false G was selected as the spacer nucleotide as per Briggs et al., 2012. Sticky End 1 was chosen as per Briggs et al., 2012. false Joseph L Maniaci BBa_K2066008 1 BBa_K2066008 Tet Monomer A w/ 64 bp spacer for ICA 2016-10-08T11:00:00Z 2016-10-12T12:01:56Z This part was synthesized as a gBlock from IDT. The part is flanked by UNS 2 and UNS 3 as per the WM UNS gibson cloning standard. This part is the TetO, 64BP spacer 'A' monomer for use in ICA to create repeated TetO Arrays of variable length. The monomer can be PCR amplified using UNS 4 and UNS 5 PCR landing pads. Next, the part should cut with BsmBI restriction enzyme to expose sticky ends and used to extend monomer in ICA. Monomer A (this part) can bind to the initiator sequence (available on our wiki) or Monomer C. This part contains the following: UNS 2 (WM standard gibson/amplification primer site) ??? UNS 4 (used to provide orthogonal amplification of monomers alone) ??? BsmBI site ??? sticky end 1 - Tet Repeat ??? 64 bp spacer (taken as first 64 bp from UNS X) ??? BsmBI site ??? Sticky end 2 - UNS 5 (orthogonal amplification in conjunction with UNS 4) ??? UNS 3 (WM standard gibson/amplification primer site). ICA method and sequence design based on Briggs et al., 2012 and its supplement. Briggs, A. W., Rios, X., Chari, R., Yang, L., Zhang, F., Mali, P., & Church, G. M. (2012). Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. Nucleic acids research, gks624. The UNS2, UNS3, UNS 4, and UNS 5 sequences are taken from Torella et al. 2013 and are ideal for cloning long sequences of monomers. Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. false false _2534_ 27446 27446 9 false Design of monomer part was based off of TALEN monomer design in Briggs et al., 2012. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss component2494494 1 BBa_K2066021 component2494490 1 BBa_K2066501 component2494493 1 BBa_K2066504 component2494492 1 BBa_K2066522 component2494488 1 BBa_K2066018 component2494489 1 BBa_K2066020 component2494495 1 BBa_K2066019 component2494491 1 BBa_K2066502 annotation2494490 1 BBa_K2066501 range2494490 1 81 91 annotation2494491 1 BBa_K2066502 range2494491 1 92 110 annotation2494493 1 BBa_K2066504 range2494493 1 175 185 annotation2494495 1 BBa_K2066019 range2494495 1 226 265 annotation2494488 1 BBa_K2066018 range2494488 1 1 40 annotation2494489 1 BBa_K2066020 range2494489 1 41 80 annotation2494492 1 BBa_K2066522 range2494492 1 111 174 annotation2494494 1 BBa_K2066021 range2494494 1 186 225 BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066504 1 BBa_K2066504 ICA:BsmBI Cut Site + G + Sticky End 2 2016-08-24T11:00:00Z 2016-08-25T11:55:55Z This part was synthesized as part of a gBlock / using IDT DNA synthesis. Part sequence based off of supplemental material from Briggs et al., 2012. This is an intermediate part used in the construction of WM16_002. This part contains the BsmBI cut site followed by a single nucleotide spacer (G) followed by sticky end 2. Sticky end 2 is one of three sticky ends used by WM iGEM 2016 for Iterative Capped Assembly. ICA design method based off of Briggs, A. W., Rios, X., Chari, R., Yang, L., Zhang, F., Mali, P., & Church, G. M. (2012). Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. Nucleic acids research, gks624. false false _2534_ 31526 27446 9 false G was selected as the spacer nucleotide as per Briggs et al., 2012. Sticky End 2 was chosen as per supplemental material from Briggs et al., 2012. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066502 1 BBa_K2066502 1xTetO Binding Site 2016-08-24T11:00:00Z 2016-08-25T07:55:30Z This part was synthesized as part of a gBlock / using IDT DNA synthesis. Tet Operator Sequence based off of Addgene Plasmid #17655. This is an intermediate part used in the construction of WM16 TetO ICA parts (WM16_K2066002-WM16_K2066010). This part contains the TetO repeat sequence used by WM for ICA creation of TetO binding arrays. Tet Operator Sequence based off of Addgene Plasmid #17655. ICA design method based off of Briggs, A. W., Rios, X., Chari, R., Yang, L., Zhang, F., Mali, P., & Church, G. M. (2012). Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. Nucleic acids research, gks624. false false _2534_ 27446 27446 9 false n/a false Joseph L Maniaci BBa_K2066522 1 BBa_K2066522 64BP Spacer, UNS X + first 24 UNS X 2016-10-08T11:00:00Z 2016-10-09T08:55:48Z This part was synthesized as part of a gBlock/ using IDT DNA synthesis. Part sequence is first 16 bp of UNS X sequence from Torella et al., 2013. This is an intermediate part used in the construction of WK2066008 - K2066010. This part is a spacer region. The sequence is the UNS X sequence followed by the first 24 base pairs from the USN X sequence. UNS X sequence is from the supplemental material of Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. false false _2534_ 27446 27446 9 false N/A false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066019 1 BBa_K2066019 UNS 3 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:43:00Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 3, (UNS 3), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false This UNS sequence was chosen to serve as the 3' primer in our standard because it works well with UNS 2 and it adheres to the BioBrick standards. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066021 1 BBa_K2066021 UNS 5 Sequence, from Torella et al., 2013 2016-08-24T11:00:00Z 2016-10-19T05:45:29Z This part was synthesized as part of a gBlock / using IDT DNA synthesis. Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 5, (UNS 5), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false UNS 5 was chosen along with UNS 4 to serve as primer binding sites which will create an amplicon that contains the base sequence for our ICA monomer but does not contain USN 2 or 3. false Joseph L Maniaci BBa_K2066020 1 BBa_K2066020 UNS 4 Sequence, from Torella et al., 2013 2016-08-24T11:00:00Z 2016-10-19T05:44:31Z This part was synthesized as part of a gBlock / using IDT DNA synthesis. Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 4, (UNS 4), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false UNS 4 was chosen along with UNS 5 to serve as primer binding sites which will create an amplicon that contains the base sequence for our ICA monomer but does not contain USN 2 or 3. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066501_sequence 1 cgtctcgcctg BBa_K2066019_sequence 1 gcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066008_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagcctgacctcctgccagcaatagtaagacaacacgcaaagtccgtctcgcctgtccctatcagtgatagagaccaggatacatagattaccacaactccgagcccttccaccccaggatacatagattaccacaaccgtctcggctagagccaactccctttacaacctcactcaagtccgttagaggcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_K2066502_sequence 1 tccctatcagtgatagaga BBa_K2066504_sequence 1 cgtctcggcta BBa_K2066020_sequence 1 ctgacctcctgccagcaatagtaagacaacacgcaaagtc BBa_K2066021_sequence 1 gagccaactccctttacaacctcactcaagtccgttagag BBa_K2066522_sequence 1 ccaggatacatagattaccacaactccgagcccttccaccccaggatacatagattaccacaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z