BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K2066508 1 BBa_K2066508 Modified pLacO-1 Promoter (Lou et. al 2012) 2016-08-30T11:00:00Z 2016-08-31T09:01:04Z Part sequence inspired by Lou et al. 2012 (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???) This promoter sequence is modified from section V of Supplementary Material of Lou et al. The Supplementary sequence contains 98bp of the end of BioBrick backbone pSB1C3, followed by an EcoRI site and an XbaI site, then 20bp of the beginning of pTac (as described in fig. S1), before beginning the sequence of plLacO-1 (as described in fig. S1). Here we use only the 20bp of pTac followed by the plLacO-1 sequence as described in fig. S1. WM iGEM 2016 used this part for our Ribozyme Characterization project. false false _2534_ 31541 31541 9 false Design inspired by Lou et al. 2012 (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???) so that constitutive LacI repressor can bind to it. false Likhitha Kolla BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066511 1 BBa_K2066511 cI-GFP 2016-08-31T11:00:00Z 2016-09-01T05:55:35Z The sequence is modified from Lou et al. Supplement section V "Ribozyme-based insulator parts buffer synthetic circuits from genetic context". cI-GFP is used for our Ribozyme Characterization project. It is a reporter molecule fused with cI used to look at the input-output transfer functions of IPTG-cIGFP both with the RiboJ insulator and without (Lou et al 2012). The sequence is modified from Lou et al. Supplement section V. However, within this sequence the T at position 1161 used to be a G; the T at 1166 used to be a C; the C at 1215 used to be a T; the A at 1282 used to be a C. All single-nucleotide substitutions were designed to preserve amino acid sequence and result in a <1% change in codon usage frequency in E. coli.) false false _2534_ 31541 31541 9 false We wanted this part for our ribozyme characterization project. false Likhitha Kolla BBa_K2066510 1 BBa_K2066510 Strong RBS from Lou et. al 2012 2016-08-30T11:00:00Z 2016-08-31T09:32:28Z Sequence is from from Lou et al. Supplement section V. This part is a strong RBS from Lou et. al 2012 "Ribozyme-based insulator parts buffer synthetic circuits from genetic context". The RBS is used to make some of 2016 WM iGEM Ribozyme Characterization project parts. false false _2534_ 31541 31541 9 false RBS sequence from Lou et. al 2012 false Likhitha Kolla BBa_K2066015 1 BBa_K2066015 plLac0-1+RiboJ+cI-GFP 2016-08-31T11:00:00Z 2016-10-14T09:02:52Z The promoter, RBS, RiboJ, and cI-GFP sequences were derived and modified from Lou et. al 2012 "Ribozyme-based insulator parts buffer synthetic circuits from genetic context". The UNS sequences are from Torella et al. 2013. This part is used for 2016 WM iGEM Ribozyme Characterization project. Lou et. al showed that sequences in the 5' UTR of a gene can affect the input-output relationship (transfer function) of a circuit. The RiboJ serves as an insulator to generalize the transfer function of a circuit regardless of promoter. The part is used in combination with BBa_K2066016 (constitutive Lac Repressor) to look at input-output relationship of IPTG-cIGFP. false false _2534_ 31541 31541 9 false We made this part for our Ribozyme Characterization project to see the effect of adding a RiboJ (ribozyme insulator) sequence in the 5' UTR on the input-ouput relationship (transfer function). false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss component2494774 1 BBa_K2066510 component2494771 1 BBa_K2066018 component2494775 1 BBa_K2066511 component2494783 1 BBa_K2066019 component2494773 1 BBa_K2066506 component2494772 1 BBa_K2066508 component2494782 1 BBa_B0015 annotation2494775 1 BBa_K2066511 range2494775 1 212 1651 annotation2494782 1 BBa_B0015 range2494782 1 1652 1780 annotation2494772 1 BBa_K2066508 range2494772 1 41 118 annotation2494771 1 BBa_K2066018 range2494771 1 1 40 annotation2494774 1 BBa_K2066510 range2494774 1 200 211 annotation2494773 1 BBa_K2066506 range2494773 1 119 199 annotation2494783 1 BBa_K2066019 range2494783 1 1781 1820 BBa_K2066019 1 BBa_K2066019 UNS 3 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:43:00Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 3, (UNS 3), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false This UNS sequence was chosen to serve as the 3' primer in our standard because it works well with UNS 2 and it adheres to the BioBrick standards. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K2066506 1 BBa_K2066506 RiboJ (Ribozyme Insulator) Lou et. al. 2012 2016-08-30T11:00:00Z 2016-10-12T12:27:33Z Part sequence is from Lou et al. 2012, Supplemental Section V (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???). RiboJ is the sequence for a ribozyme studied in Lou et. al 2012 ("Ribozyme-based insulator parts buffer synthetic circuits from genetic context"). WM iGEM 2016 used this sequence between the promoter and ribosome sequence. One of our goals for using this part is moving it onto a Biobrick backbone. Furthermore, In Lou et. al, this ribozyme sequence was said to act as an insulator which generalizes protein expression levels for a given promoter. We used RiboJ to collect data for our Ribozyme characterization project as well as our ribosome and promoter characterization projects. false false _2534_ 27446 31541 9 false We designed this part to use as an insulator and also move this riboJ sequence onto a Biobrick backbone. false Likhitha Kolla BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2066019_sequence 1 gcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066510_sequence 1 aggaggaaaaaa BBa_K2066508_sequence 1 ggcaaatattctgaaatgagctgataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcac BBa_K2066506_sequence 1 agctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaaactaga BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_K2066511_sequence 1 gtgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcggcggtggcggtcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtgtacattaccgcagataaacaaaaaaatggcattaaagcgaatttcaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatga BBa_K2066015_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagcggcaaatattctgaaatgagctgataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcacagctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaaactagaaggaggaaaaaagtgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcggcggtggcggtcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtgtacattaccgcagataaacaaaaaaatggcattaaagcgaatttcaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z