BBa_K2066017 1 BBa_K2066017 240x TetO on UNS Standard 2016-10-11T11:00:00Z 2016-10-28T11:11:44Z Constructed from registry parts. UNS sequences taken from Torella et al., 2013 This is a J23101 driving a LacI repressor with no LVA tail. This is used as a repressor for testing functionality of parts in the circuit control toolbox. true false _2534_ 27446 31526 9 false UNS sequences are used to place part on universal backbone. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss component2500788 1 BBa_K2066018 component2500789 1 BBa_K2066019 annotation2500788 1 BBa_K2066018 range2500788 1 1 40 annotation2500789 1 BBa_K2066019 range2500789 1 41 80 BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066019 1 BBa_K2066019 UNS 3 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:43:00Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 3, (UNS 3), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false This UNS sequence was chosen to serve as the 3' primer in our standard because it works well with UNS 2 and it adheres to the BioBrick standards. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066019_sequence 1 gcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_K2066017_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagcgcactgaaggtcctcaatcgcactggaaacatcaaggtcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z