BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K2066030 1 BBa_K2066030 pTAC sfGFP 2016-10-05T11:00:00Z 2016-10-19T05:30:24Z Sequence follows Lou et al. (2012) and was synthesized using parts from the iGEM registry as well as UNS spacer sequences from Torella et. al (2013). This part was designed to be assembled via Gibson Assembly from WM16_014 (using primers WM16_P027 and WM16_P009) and the same WM16_014 again (using primers WM16_P019 and WM16_P025). This part follows Lou et al. 2012 (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???). This part will be used in concert with WM16_031 (pTAC Ribozyme Chracterization Part ??? cI GFP; no RiboJ) to determine the influence of the RiboJ insulator sequence on gene expression. false false _2534_ 31544 31544 9 false false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss component2494718 1 BBa_K2066509 component2494716 1 BBa_K2066528 component2494726 1 BBa_K2066019 component2494725 1 BBa_B0015 component2494715 1 BBa_K864400 component2494717 1 BBa_K2066510 component2494710 1 BBa_K2066018 annotation2494718 1 BBa_K2066509 range2494718 1 120 839 annotation2494725 1 BBa_B0015 range2494725 1 840 968 annotation2494710 1 BBa_K2066018 range2494710 1 1 40 annotation2494716 1 BBa_K2066528 range2494716 1 102 107 annotation2494726 1 BBa_K2066019 range2494726 1 969 1008 annotation2494717 1 BBa_K2066510 range2494717 1 108 119 annotation2494715 1 BBa_K864400 range2494715 1 41 101 BBa_K2066528 1 BBa_K2066528 ACTAGA Scar 2016-10-11T11:00:00Z 2016-10-12T12:34:02Z ACTAGA, scar present in Lou et al. 2012 ???Ribozyme-based insulator parts buffer synthetic circuits from genetic context??? RiboJ sequence, Supplement Section V. This is the scar as the end of the RiboJ sequence (Lou et al. 2012) which we conserved through all of our uses of RiboJ <partinfo>BBa_K2066506<\partinfo>. This exists as a parts page so that it can be inserted into sequences which do not have RiboJ but still have the scar for the sake of continuity. false false _2534_ 27446 27446 9 false N/A false Joseph L Maniaci BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066510 1 BBa_K2066510 Strong RBS from Lou et. al 2012 2016-08-30T11:00:00Z 2016-08-31T09:32:28Z Sequence is from from Lou et al. Supplement section V. This part is a strong RBS from Lou et. al 2012 "Ribozyme-based insulator parts buffer synthetic circuits from genetic context". The RBS is used to make some of 2016 WM iGEM Ribozyme Characterization project parts. false false _2534_ 31541 31541 9 false RBS sequence from Lou et. al 2012 false Likhitha Kolla BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K2066509 1 BBa_K2066509 sfGFP 2016-08-30T11:00:00Z 2016-10-19T02:54:25Z The sequence for this sfGFP reporter gene is modified from Lou et al. Supplement section V. This is the sequence of superfolder GFP BBa_I746916, but with four codon modifications to match WM16_015: at position 441, G->T. At 446, C->T. At 495, T->C. At 562, C->A. The part is a reporter used for K2066014. false false _2534_ 31541 31541 9 false Design inspired by Lou et. al. 2012 false Likhitha Kolla BBa_K2066019 1 BBa_K2066019 UNS 3 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:43:00Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 3, (UNS 3), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false This UNS sequence was chosen to serve as the 3' primer in our standard because it works well with UNS 2 and it adheres to the BioBrick standards. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K864400 1 BBa_K864400 Ptac, trp & lac regulated promoter 2012-09-24T11:00:00Z 2015-05-08T01:13:37Z Created from oligos ordered from SigmaAldrich. Oligo sequences: Ptac+ AATTCGCGGCCGCTTCTAGAGGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTA Ptac- CTAGTAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGATGATTAATTGTCAACAGCTCCTCTAGAAGCGGCCGCG Released HQ 2013 The Ptac promoter is a functional hybrid promoter, derived from the trp and lac promoters, that are regulated by trp and lac [1]. This part also exist together with lacI, part [[Part:BBa_K180000|BBa_K180000]] [1] Proc. Natl. Acad. Sci. USA, Vol. 80, pp. 21-25 false false _1124_ 0 9827 9 In stock false Oligos ordered from SigmaAldrich were annealed to form a double stranded DNA segment, ready to be ligated into any BioBrick backbone. false Erik Lundin annotation2197240 1 lacO1 site range2197240 1 36 61 annotation2197238 1 -10 range2197238 1 29 33 annotation2197237 1 -35 range2197237 1 7 12 annotation2197236 1 Ptac range2197236 1 1 40 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2066509_sequence 1 atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtgtacattaccgcagataaacaaaaaaatggcattaaagcgaatttcaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatga BBa_K2066019_sequence 1 gcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066510_sequence 1 aggaggaaaaaa BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K2066030_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagcgagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaattactagaaggaggaaaaaaatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtgtacattaccgcagataaacaaaaaaatggcattaaagcgaatttcaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K864400_sequence 1 gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatt BBa_K2066528_sequence 1 actaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z