BBa_K2066040 1 BBa_K2066040 J23100 + RiboJ Promoter Characterization Part with 2x Broccoli 2016-10-13T11:00:00Z 2016-10-16T11:44:59Z to be completed to be completed false false _2534_ 0 27446 27446 9 It's complicated false to be completed false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss component2513008 1 BBa_K2066519 component2513005 1 BBa_K2066535 component2513007 1 BBa_K2066518 component2513004 1 BBa_J23100 component2513010 1 BBa_K2066520 component2513019 1 BBa_K2066019 component2513018 1 BBa_B0015 component2513003 1 BBa_K2066018 component2513006 1 BBa_K2066527 component2513009 1 BBa_K2066507 component2513011 1 BBa_K2066521 annotation2513006 1 BBa_K2066527 range2513006 1 151 168 annotation2513008 1 BBa_K2066519 range2513008 1 883 912 annotation2513011 1 BBa_K2066521 range2513011 1 1167 1186 annotation2513009 1 BBa_K2066507 range2513009 1 913 932 annotation2513019 1 BBa_K2066019 range2513019 1 1316 1355 annotation2513018 1 BBa_B0015 range2513018 1 1187 1315 annotation2513004 1 BBa_J23100 range2513004 1 41 75 annotation2513010 1 BBa_K2066520 range2513010 1 933 1166 annotation2513003 1 BBa_K2066018 range2513003 1 1 40 annotation2513005 1 BBa_K2066535 range2513005 1 76 150 annotation2513007 1 BBa_K2066518 range2513007 1 169 882 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K2066518 1 BBa_K2066518 mCherry (with start codon) 2016-10-07T11:00:00Z 2016-10-08T10:50:28Z Modified from the mCherry used in K2066028 and K2066029 to include the start codon. This modified mCherry is used in the construction of K2066040 and K2066041. false false _2534_ 31544 31544 9 false The start codon was removed in K2066028 and K2066029 to follow the design from Synthetic Analog Computation in Living Cells (Daniel et al.) where the codon bias was being optimized. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066527 1 BBa_K2066527 B0034 with scar TACTAG 2016-10-11T11:00:00Z 2016-10-12T11:39:15Z Bba_B0034 + TACTAG This is part B0034 with the scar region TACTAG added onto the part so that the correct scar region will be present in WM composite parts K2066059 - K20660108. This has no other purpose, but is just necessary do the system of the registry. false false _2534_ 27446 27446 9 false N/A false Joseph L Maniaci BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K2066521 1 BBa_K2066521 UNS 6.2 2016-10-08T11:00:00Z 2016-10-19T06:13:17Z Torella et al. 2013 (???Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly???) The second half of UNS 6. The sequence is taken from Torella et al. 2013 (???Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly???). This is used in K2066040 and K2066041. false false _2534_ 31544 31544 9 false false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066535 1 BBa_K2066535 53mp`5m3p`5 2016-10-13T11:00:00Z 2016-10-16T10:28:33Z te temp false false _2534_ 27446 27645 9 false mpt false John Marken BBa_K2066507 1 BBa_K2066507 UNS 6.1 (Torella et. al 2013) 2016-08-30T11:00:00Z 2016-10-19T06:10:34Z UNS 6.1 sequence derived from (Torella et. al 2013) "Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly". This part is used as a spacer. WM iGEM 2016 used this part as a spacer to connect two separate composite parts onto the same plasmid. For example, UNS 6.1 was used as a spacer to connect K2066022(TetR on UNS) and K2066023(pTET GFP on UNS) to make K2066053. false false _2534_ 31544 31541 9 false Used this part as a spacer. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066019 1 BBa_K2066019 UNS 3 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:43:00Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 3, (UNS 3), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false This UNS sequence was chosen to serve as the 3' primer in our standard because it works well with UNS 2 and it adheres to the BioBrick standards. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066520 1 BBa_K2066520 F30 scaffold / 2xBroccoli 2016-10-08T11:00:00Z 2016-10-08T11:16:28Z The broccoli sequence is from https://www.addgene.org/66843/. This part is meant for use in Promoter Characterization and RBS Characterization subproject for WM iGEM 2016. false false _2534_ 31544 31544 9 false The part does have a SpeI cutsite in the Spinach aptamer. We???re going to use the original spinach to replicate the results of Pothoulakis et al. as exactly as possible and try to move to the Broccoli aptamer (which is RFC10 compatible) as soon as possible. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K2066519 1 BBa_K2066519 spacer sB 2016-10-08T11:00:00Z 2016-10-08T11:01:16Z Pothoulakis et al. 2013 (???The Spinach RNA Aptamer as a Characterization Tool for Synthetic Biology???). The spacer sB is taken from Pothoulakis et al. 2013 (???The Spinach RNA Aptamer as a Characterization Tool for Synthetic Biology???) and used in the construction of K2066040 and K2066041. false false _2534_ 31544 31544 9 false false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066019_sequence 1 gcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066040_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagcttgacggctagctcagtcctaggtacagtgctagcagctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaaaaagaggagaaatactagatggtgagcaagggcgaagaagataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataactctacgacaacctcttcacagccaatctcctcgttcgctgccacctaagttgccatgtgtatgtgggagacggtcgggtccatctgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcagatgtcgagtagagtgtgggctcccacatactctgatgatccagacggtcgggtccatctgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcagatgtcgagtagagtgtgggctggatcattcatggcaaaatactctacggtcacatacccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066520_sequence 1 ttgccatgtgtatgtgggagacggtcgggtccatctgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcagatgtcgagtagagtgtgggctcccacatactctgatgatccagacggtcgggtccatctgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcagatgtcgagtagagtgtgggctggatcattcatggcaa BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_K2066507_sequence 1 ctcgttcgctgccacctaag BBa_K2066527_sequence 1 aaagaggagaaatactag BBa_K2066521_sequence 1 aatactctacggtcacatac BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2066518_sequence 1 atggtgagcaagggcgaagaagataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa BBa_K2066535_sequence 1 agctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaa BBa_K2066519_sequence 1 ctctacgacaacctcttcacagccaatctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z