BBa_K2066508 1 BBa_K2066508 Modified pLacO-1 Promoter (Lou et. al 2012) 2016-08-30T11:00:00Z 2016-08-31T09:01:04Z Part sequence inspired by Lou et al. 2012 (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???) This promoter sequence is modified from section V of Supplementary Material of Lou et al. The Supplementary sequence contains 98bp of the end of BioBrick backbone pSB1C3, followed by an EcoRI site and an XbaI site, then 20bp of the beginning of pTac (as described in fig. S1), before beginning the sequence of plLacO-1 (as described in fig. S1). Here we use only the 20bp of pTac followed by the plLacO-1 sequence as described in fig. S1. WM iGEM 2016 used this part for our Ribozyme Characterization project. false false _2534_ 31541 31541 9 false Design inspired by Lou et al. 2012 (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???) so that constitutive LacI repressor can bind to it. false Likhitha Kolla BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066509 1 BBa_K2066509 sfGFP 2016-08-30T11:00:00Z 2016-10-19T02:54:25Z The sequence for this sfGFP reporter gene is modified from Lou et al. Supplement section V. This is the sequence of superfolder GFP BBa_I746916, but with four codon modifications to match WM16_015: at position 441, G->T. At 446, C->T. At 495, T->C. At 562, C->A. The part is a reporter used for K2066014. false false _2534_ 31541 31541 9 false Design inspired by Lou et. al. 2012 false Likhitha Kolla BBa_K2066019 1 BBa_K2066019 UNS 3 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:43:00Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 3, (UNS 3), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false This UNS sequence was chosen to serve as the 3' primer in our standard because it works well with UNS 2 and it adheres to the BioBrick standards. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066048 1 BBa_K2066048 B0032 IPTG-Inducible RBS Measurement Part 2016-10-07T11:00:00Z 2016-10-12T01:32:28Z This part was assembled from existing BioBrick parts. This part is part of William and Mary iGEM 2016's library of IPTG-inducible RBS characterization parts. It contains the RBS BBa_B0032. The part codes for the expression of a superfolder GFP and is regulated by a lacI-repressible plLacO-1 Promoter. By adding IPTG one should be able to induce the expression of sfGFP and compare the induction curve to other IPTG-inducible RBS characterization parts from our library to determine the relative strengths of different RBS sequences across an induction curve. We have included the self-cleaving ribozyme RiboJ immediately upstream of the RBS sequence in order to buffer against translational influence from the 5' untranslated region conferred to the transcript by the promoter sequence. false false _2534_ 27446 27645 9 false See Design Details for individual parts plLacO-1 (K2066508) and sfGFP (K2066509) false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss component2495109 1 BBa_B0015 component2495100 1 BBa_B0032 component2495096 1 BBa_K2066018 component2495110 1 BBa_K2066019 component2495097 1 BBa_K2066508 component2495098 1 BBa_K2066506 component2495102 1 BBa_K2066509 annotation2495097 1 BBa_K2066508 range2495097 1 41 118 annotation2495110 1 BBa_K2066019 range2495110 1 1062 1101 annotation2495096 1 BBa_K2066018 range2495096 1 1 40 annotation2495102 1 BBa_K2066509 range2495102 1 213 932 annotation2495100 1 BBa_B0032 range2495100 1 200 212 annotation2495109 1 BBa_B0015 range2495109 1 933 1061 annotation2495098 1 BBa_K2066506 range2495098 1 119 199 BBa_K2066506 1 BBa_K2066506 RiboJ (Ribozyme Insulator) Lou et. al. 2012 2016-08-30T11:00:00Z 2016-10-12T12:27:33Z Part sequence is from Lou et al. 2012, Supplemental Section V (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???). RiboJ is the sequence for a ribozyme studied in Lou et. al 2012 ("Ribozyme-based insulator parts buffer synthetic circuits from genetic context"). WM iGEM 2016 used this sequence between the promoter and ribosome sequence. One of our goals for using this part is moving it onto a Biobrick backbone. Furthermore, In Lou et. al, this ribozyme sequence was said to act as an insulator which generalizes protein expression levels for a given promoter. We used RiboJ to collect data for our Ribozyme characterization project as well as our ribosome and promoter characterization projects. false false _2534_ 27446 31541 9 false We designed this part to use as an insulator and also move this riboJ sequence onto a Biobrick backbone. false Likhitha Kolla BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2066509_sequence 1 atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtgtacattaccgcagataaacaaaaaaatggcattaaagcgaatttcaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatga BBa_K2066019_sequence 1 gcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066048_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagcggcaaatattctgaaatgagctgataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcacagctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaaactagatcacacaggaaagatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtgtacattaccgcagataaacaaaaaaatggcattaaagcgaatttcaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066508_sequence 1 ggcaaatattctgaaatgagctgataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcac BBa_K2066506_sequence 1 agctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaaactaga BBa_B0032_sequence 1 tcacacaggaaag BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z