BBa_K2066055 1 BBa_K2066055 T7 Promoter without RiboJ Promoter Characterization Part 2016-10-13T11:00:00Z 2016-10-19T08:22:26Z to be completed to be completed false false _2534_ 31544 27446 9 false to be completed false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss component2523919 1 BBa_K2066021 component2523915 1 BBa_K2066518 component2523917 1 BBa_K2066507 component2523918 1 BBa_K2066520 component2523912 1 BBa_K2066018 component2523914 1 BBa_K2066527 component2523922 1 BBa_B0012 component2523926 1 BBa_K2066019 component2523920 1 BBa_B0010 component2523913 1 BBa_K2066537 component2523916 1 BBa_K2066519 annotation2523920 1 BBa_B0010 range2523920 1 1117 1196 annotation2523922 1 BBa_B0012 range2523922 1 1197 1237 annotation2523916 1 BBa_K2066519 range2523916 1 793 822 annotation2523917 1 BBa_K2066507 range2523917 1 823 842 annotation2523912 1 BBa_K2066018 range2523912 1 1 40 annotation2523926 1 BBa_K2066019 range2523926 1 1238 1277 annotation2523919 1 BBa_K2066021 range2523919 1 1077 1116 annotation2523918 1 BBa_K2066520 range2523918 1 843 1076 annotation2523913 1 BBa_K2066537 range2523913 1 41 60 annotation2523914 1 BBa_K2066527 range2523914 1 61 78 annotation2523915 1 BBa_K2066518 range2523915 1 79 792 BBa_K2066507 1 BBa_K2066507 UNS 6.1 (Torella et. al 2013) 2016-08-30T11:00:00Z 2016-10-19T06:10:34Z UNS 6.1 sequence derived from (Torella et. al 2013) "Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly". This part is used as a spacer. WM iGEM 2016 used this part as a spacer to connect two separate composite parts onto the same plasmid. For example, UNS 6.1 was used as a spacer to connect K2066022(TetR on UNS) and K2066023(pTET GFP on UNS) to make K2066053. false false _2534_ 31544 31541 9 false Used this part as a spacer. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066537 1 BBa_K2066537 t7 promoter 2016-10-13T11:00:00Z 2016-10-16T03:24:53Z ptm tem false false _2534_ 27446 27645 9 false p false John Marken BBa_K2066019 1 BBa_K2066019 UNS 3 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:43:00Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 3, (UNS 3), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false This UNS sequence was chosen to serve as the 3' primer in our standard because it works well with UNS 2 and it adheres to the BioBrick standards. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066021 1 BBa_K2066021 UNS 5 Sequence, from Torella et al., 2013 2016-08-24T11:00:00Z 2016-10-19T05:45:29Z This part was synthesized as part of a gBlock / using IDT DNA synthesis. Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 5, (UNS 5), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false UNS 5 was chosen along with UNS 4 to serve as primer binding sites which will create an amplicon that contains the base sequence for our ICA monomer but does not contain USN 2 or 3. false Joseph L Maniaci BBa_K2066520 1 BBa_K2066520 F30 scaffold / 2xBroccoli 2016-10-08T11:00:00Z 2016-10-08T11:16:28Z The broccoli sequence is from https://www.addgene.org/66843/. This part is meant for use in Promoter Characterization and RBS Characterization subproject for WM iGEM 2016. false false _2534_ 31544 31544 9 false The part does have a SpeI cutsite in the Spinach aptamer. We???re going to use the original spinach to replicate the results of Pothoulakis et al. as exactly as possible and try to move to the Broccoli aptamer (which is RFC10 compatible) as soon as possible. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066518 1 BBa_K2066518 mCherry (with start codon) 2016-10-07T11:00:00Z 2016-10-08T10:50:28Z Modified from the mCherry used in K2066028 and K2066029 to include the start codon. This modified mCherry is used in the construction of K2066040 and K2066041. false false _2534_ 31544 31544 9 false The start codon was removed in K2066028 and K2066029 to follow the design from Synthetic Analog Computation in Living Cells (Daniel et al.) where the codon bias was being optimized. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K2066527 1 BBa_K2066527 B0034 with scar TACTAG 2016-10-11T11:00:00Z 2016-10-12T11:39:15Z Bba_B0034 + TACTAG This is part B0034 with the scar region TACTAG added onto the part so that the correct scar region will be present in WM composite parts K2066059 - K20660108. This has no other purpose, but is just necessary do the system of the registry. false false _2534_ 27446 27446 9 false N/A false Joseph L Maniaci BBa_K2066519 1 BBa_K2066519 spacer sB 2016-10-08T11:00:00Z 2016-10-08T11:01:16Z Pothoulakis et al. 2013 (???The Spinach RNA Aptamer as a Characterization Tool for Synthetic Biology???). The spacer sB is taken from Pothoulakis et al. 2013 (???The Spinach RNA Aptamer as a Characterization Tool for Synthetic Biology???) and used in the construction of K2066040 and K2066041. false false _2534_ 31544 31544 9 false false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2066537_sequence 1 taatacgactcactataggg BBa_K2066518_sequence 1 atggtgagcaagggcgaagaagataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa BBa_K2066019_sequence 1 gcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066520_sequence 1 ttgccatgtgtatgtgggagacggtcgggtccatctgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcagatgtcgagtagagtgtgggctcccacatactctgatgatccagacggtcgggtccatctgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcagatgtcgagtagagtgtgggctggatcattcatggcaa BBa_K2066055_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagctaatacgactcactatagggaaagaggagaaatactagatggtgagcaagggcgaagaagataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataactctacgacaacctcttcacagccaatctcctcgttcgctgccacctaagttgccatgtgtatgtgggagacggtcgggtccatctgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcagatgtcgagtagagtgtgggctcccacatactctgatgatccagacggtcgggtccatctgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcagatgtcgagtagagtgtgggctggatcattcatggcaagagccaactccctttacaacctcactcaagtccgttagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttatagcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_K2066507_sequence 1 ctcgttcgctgccacctaag BBa_K2066519_sequence 1 ctctacgacaacctcttcacagccaatctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K2066021_sequence 1 gagccaactccctttacaacctcactcaagtccgttagag BBa_K2066527_sequence 1 aaagaggagaaatactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z