BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K2066057 1 BBa_K2066057 J23100+RiboJ+sfGFP 2016-10-13T11:00:00Z 2016-10-19T07:14:01Z to be cmopleted to be completed false false _2534_ 31544 27446 9 false to be completed false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss component2513536 1 BBa_K2066018 component2513547 1 BBa_B0015 component2513540 1 BBa_K2066509 component2513539 1 BBa_K2066510 component2513538 1 BBa_K2066506 component2513537 1 BBa_J23100 component2513548 1 BBa_K2066019 annotation2513539 1 BBa_K2066510 range2513539 1 157 168 annotation2513548 1 BBa_K2066019 range2513548 1 1018 1057 annotation2513537 1 BBa_J23100 range2513537 1 41 75 annotation2513536 1 BBa_K2066018 range2513536 1 1 40 annotation2513538 1 BBa_K2066506 range2513538 1 76 156 annotation2513547 1 BBa_B0015 range2513547 1 889 1017 annotation2513540 1 BBa_K2066509 range2513540 1 169 888 BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066510 1 BBa_K2066510 Strong RBS from Lou et. al 2012 2016-08-30T11:00:00Z 2016-08-31T09:32:28Z Sequence is from from Lou et al. Supplement section V. This part is a strong RBS from Lou et. al 2012 "Ribozyme-based insulator parts buffer synthetic circuits from genetic context". The RBS is used to make some of 2016 WM iGEM Ribozyme Characterization project parts. false false _2534_ 31541 31541 9 false RBS sequence from Lou et. al 2012 false Likhitha Kolla BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K2066509 1 BBa_K2066509 sfGFP 2016-08-30T11:00:00Z 2016-10-19T02:54:25Z The sequence for this sfGFP reporter gene is modified from Lou et al. Supplement section V. This is the sequence of superfolder GFP BBa_I746916, but with four codon modifications to match WM16_015: at position 441, G->T. At 446, C->T. At 495, T->C. At 562, C->A. The part is a reporter used for K2066014. false false _2534_ 31541 31541 9 false Design inspired by Lou et. al. 2012 false Likhitha Kolla BBa_K2066019 1 BBa_K2066019 UNS 3 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:43:00Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 3, (UNS 3), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false This UNS sequence was chosen to serve as the 3' primer in our standard because it works well with UNS 2 and it adheres to the BioBrick standards. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066506 1 BBa_K2066506 RiboJ (Ribozyme Insulator) Lou et. al. 2012 2016-08-30T11:00:00Z 2016-10-12T12:27:33Z Part sequence is from Lou et al. 2012, Supplemental Section V (???Ribozyme-based insulator parts buffer synthetic circuits from genetic context???). RiboJ is the sequence for a ribozyme studied in Lou et. al 2012 ("Ribozyme-based insulator parts buffer synthetic circuits from genetic context"). WM iGEM 2016 used this sequence between the promoter and ribosome sequence. One of our goals for using this part is moving it onto a Biobrick backbone. Furthermore, In Lou et. al, this ribozyme sequence was said to act as an insulator which generalizes protein expression levels for a given promoter. We used RiboJ to collect data for our Ribozyme characterization project as well as our ribosome and promoter characterization projects. false false _2534_ 27446 31541 9 false We designed this part to use as an insulator and also move this riboJ sequence onto a Biobrick backbone. false Likhitha Kolla BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2066509_sequence 1 atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtgtacattaccgcagataaacaaaaaaatggcattaaagcgaatttcaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatga BBa_K2066019_sequence 1 gcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066510_sequence 1 aggaggaaaaaa BBa_K2066506_sequence 1 agctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaaactaga BBa_K2066057_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagcttgacggctagctcagtcctaggtacagtgctagcagctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaaactagaaggaggaaaaaaatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtgtacattaccgcagataaacaaaaaaatggcattaaagcgaatttcaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z