BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066126 1 BBa_K2066126 Synthetic Enhancer Project: NRII2302 Upstream Regulatory Region with Promoter 2016-10-13T11:00:00Z 2016-10-19T05:55:12Z temp temp false false _2534_ 31541 27645 9 false temp false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, &#65532;Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss annotation2500695 1 BBa_K2066018 range2500695 1 1 40 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K2066112 1 BBa_K2066112 Synthetic Enhancer Project: Ntr promoter driven NRII2302 (mut) on UNS Standard 2016-10-13T11:00:00Z 2016-10-28T08:09:29Z To be completed To be completed false false _2534_ 31504 31547 9 false To be completed false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, &#65532;Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss component2523106 1 BBa_K2066018 component2523116 1 BBa_K2066019 component2523115 1 BBa_B0015 component2523108 1 BBa_K2066538 component2523105 1 BBa_K2066018 component2523107 1 BBa_K2066126 annotation2523105 1 BBa_K2066018 range2523105 1 1 40 annotation2523107 1 BBa_K2066126 range2523107 1 41 107 annotation2523115 1 BBa_B0015 range2523115 1 1158 1286 annotation2523116 1 BBa_K2066019 range2523116 1 1287 1326 annotation2523108 1 BBa_K2066538 range2523108 1 108 1157 annotation2523106 1 BBa_K2066018 range2523106 1 41 80 BBa_K2066019 1 BBa_K2066019 UNS 3 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:43:00Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 3, (UNS 3), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. The sequence for this part came from the following paper: Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. A huge thanks to all the researchers involved in its original creation! false false _2534_ 31544 27446 9 false This UNS sequence was chosen to serve as the 3' primer in our standard because it works well with UNS 2 and it adheres to the BioBrick standards. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K2066538 1 BBa_K2066538 Synthetic Enhancer Project: NRII2302 Mutant Coding 2016-10-13T11:00:00Z 2016-10-19T05:51:49Z te temp false false _2534_ 31541 27645 9 false mptem false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, &#65532;Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K2066112_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagcggtaggccggagcaggtgagtcgctctccaacgtgaagtttgtcagctatctgtagcccatctctgcatggcaacaggcacgcagcccgatgctgggcagatcctcaactcgctgattaacagtattttgttaatcgatgacaacctggcgatccattacgccaaccctgccgcgcaacaactgctcgcccaaagctcccgcaaattgtttggtacaccgttaccggaactgttgagctacttctcattaaatatcgagctgatgcaagaaagtctggaggcggggcaaggttttaccgataacgaagtgacgctggtcatcgacgggcgctcgcatatcctttctgtgacggcccagcgtatgccggacggcatgatcctgctggagatggctccgatggataaccagcgccgcttaagtcaggaacagctacagcacgcccagcaggttactgcccgtgatttagtgcgcggcctggcacatgagattaaaaatccgcttggcggtttacgtggcgcggcgcagctgctcagcaaagcgttacctgacccatcactactcgaatataccaaagtgattatcgaacaggcggaccggctgcgaaatctggtcgaccgtctgttggggccgcagctgcccggtacgcgcgttaccgaaagtattcacaaagtggctgaacgcgtggtaacgctggtgtcgatggaactgccggacaacgtgcggttgattcgtgattacgatcccagcctaccggaactggcgcacgacccggatcaaattgaacaggtcttgctgaatattgtgcgcaatgcgctacaggcgctggggccggaaggcggtgaaatcattctgcgtacccgcaccgcgtttcaactgaccttacacggcgagcgctaccggctggcggcgcggattgatgtggaagataacgggccgggcattccgcctcatttgcaggatacgctgttttacccgatggtcagcggccgcgaaggtggcaccgggcttggcttatccatcgctcgtaatttgattgatcagcattcaggcaaaattgaatttaccagttggccagggcataccgagttctcggtttacctgcctatcaggaaataaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K2066019_sequence 1 gcactgaaggtcctcaatcgcactggaaacatcaaggtcg BBa_K2066126_sequence 1 ggtaggccggagcaggtgagtcgctctccaacgtgaagtttgtcagctatctgtagcccatctctgc BBa_K2066538_sequence 1 atggcaacaggcacgcagcccgatgctgggcagatcctcaactcgctgattaacagtattttgttaatcgatgacaacctggcgatccattacgccaaccctgccgcgcaacaactgctcgcccaaagctcccgcaaattgtttggtacaccgttaccggaactgttgagctacttctcattaaatatcgagctgatgcaagaaagtctggaggcggggcaaggttttaccgataacgaagtgacgctggtcatcgacgggcgctcgcatatcctttctgtgacggcccagcgtatgccggacggcatgatcctgctggagatggctccgatggataaccagcgccgcttaagtcaggaacagctacagcacgcccagcaggttactgcccgtgatttagtgcgcggcctggcacatgagattaaaaatccgcttggcggtttacgtggcgcggcgcagctgctcagcaaagcgttacctgacccatcactactcgaatataccaaagtgattatcgaacaggcggaccggctgcgaaatctggtcgaccgtctgttggggccgcagctgcccggtacgcgcgttaccgaaagtattcacaaagtggctgaacgcgtggtaacgctggtgtcgatggaactgccggacaacgtgcggttgattcgtgattacgatcccagcctaccggaactggcgcacgacccggatcaaattgaacaggtcttgctgaatattgtgcgcaatgcgctacaggcgctggggccggaaggcggtgaaatcattctgcgtacccgcaccgcgtttcaactgaccttacacggcgagcgctaccggctggcggcgcggattgatgtggaagataacgggccgggcattccgcctcatttgcaggatacgctgttttacccgatggtcagcggccgcgaaggtggcaccgggcttggcttatccatcgctcgtaatttgattgatcagcattcaggcaaaattgaatttaccagttggccagggcataccgagttctcggtttacctgcctatcaggaaataa BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z