BBa_K2066018 1 BBa_K2066018 UNS 2 Sequence, from Torella et al., 2013 2016-07-11T11:00:00Z 2016-10-19T05:41:43Z Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. This is Unique Nucleotide Sequence 2, (UNS 2), from Torella et al., 2013. The William and Mary iGEM team has adopted this as our standard prefix; as such, all of our parts will have this sequence immediately following the BioBrick prefix. We took this measure in order to allow easier Gibson Assembly cloning of our parts. Primer sequences which can be used to clone with the UNS 2/3 standard can be found on our wiki. false false _2534_ 31544 27446 9 false UNS 2 was chosen because it works well with UNS 3 and it is in accordance with the BioBrick standard. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066134 1 BBa_K2066134 temp 2016-10-13T11:00:00Z 2016-10-13T11:23:30Z temp temp false false _2534_ 27645 27645 9 false tmp false John Marken component2500705 1 BBa_K2066018 annotation2500705 1 BBa_K2066018 range2500705 1 1 40 BBa_K2066134_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc BBa_K2066018_sequence 1 gctgggagttcgtagacggaaacaaacgcagaatccaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z