BBa_K2066507 1 BBa_K2066507 UNS 6.1 (Torella et. al 2013) 2016-08-30T11:00:00Z 2016-10-19T06:10:34Z UNS 6.1 sequence derived from (Torella et. al 2013) "Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly". This part is used as a spacer. WM iGEM 2016 used this part as a spacer to connect two separate composite parts onto the same plasmid. For example, UNS 6.1 was used as a spacer to connect K2066022(TetR on UNS) and K2066023(pTET GFP on UNS) to make K2066053. false false _2534_ 31544 31541 9 false Used this part as a spacer. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066507_sequence 1 ctcgttcgctgccacctaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z