BBa_K2066519 1 BBa_K2066519 spacer sB 2016-10-08T11:00:00Z 2016-10-08T11:01:16Z Pothoulakis et al. 2013 (???The Spinach RNA Aptamer as a Characterization Tool for Synthetic Biology???). The spacer sB is taken from Pothoulakis et al. 2013 (???The Spinach RNA Aptamer as a Characterization Tool for Synthetic Biology???) and used in the construction of K2066040 and K2066041. false false _2534_ 31544 31544 9 false false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066519_sequence 1 ctctacgacaacctcttcacagccaatctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z