BBa_K2066520 1 BBa_K2066520 F30 scaffold / 2xBroccoli 2016-10-08T11:00:00Z 2016-10-08T11:16:28Z The broccoli sequence is from https://www.addgene.org/66843/. This part is meant for use in Promoter Characterization and RBS Characterization subproject for WM iGEM 2016. false false _2534_ 31544 31544 9 false The part does have a SpeI cutsite in the Spinach aptamer. We???re going to use the original spinach to replicate the results of Pothoulakis et al. as exactly as possible and try to move to the Broccoli aptamer (which is RFC10 compatible) as soon as possible. false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066520_sequence 1 ttgccatgtgtatgtgggagacggtcgggtccatctgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcagatgtcgagtagagtgtgggctcccacatactctgatgatccagacggtcgggtccatctgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcagatgtcgagtagagtgtgggctggatcattcatggcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z