BBa_K2066522 1 BBa_K2066522 64BP Spacer, UNS X + first 24 UNS X 2016-10-08T11:00:00Z 2016-10-09T08:55:48Z This part was synthesized as part of a gBlock/ using IDT DNA synthesis. Part sequence is first 16 bp of UNS X sequence from Torella et al., 2013. This is an intermediate part used in the construction of WK2066008 - K2066010. This part is a spacer region. The sequence is the UNS X sequence followed by the first 24 base pairs from the USN X sequence. UNS X sequence is from the supplemental material of Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013). Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic acids research, gkt860. false false _2534_ 27446 27446 9 false N/A false Kalen Clifton, Christine Gao, Andrew Halleran, Ethan Jones, Likhitha Kolla, Joseph Maniaci, John Marken, John Mitchell, Callan Monette, Adam Reiss BBa_K2066522_sequence 1 ccaggatacatagattaccacaactccgagcccttccaccccaggatacatagattaccacaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z