BBa_K2066525 1 BBa_K2066525 LacO Repeat 2016-10-11T11:00:00Z 2016-10-12T10:41:22Z Lac Operator Sequence based off of Addgene Plasmid #17655. ICA design method based off of Briggs, A. W., Rios, X., Chari, R., Yang, L., Zhang, F., Mali, P., & Church, G. M. (2012). Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. Nucleic acids research, gks624. This is an intermediate part used in the construction of WM16 LacO ICA parts (WM16_K2066011-WM16_K2066013). This part contains the LacO repeat sequence used by WM for ICA creation of LacO binding arrays. Lac Operator Sequence based off of Addgene Plasmid #17655. ICA design method based off of Briggs, A. W., Rios, X., Chari, R., Yang, L., Zhang, F., Mali, P., & Church, G. M. (2012). Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. Nucleic acids research, gks624. false false _2534_ 27446 27446 9 false N/A false Joseph L Maniaci BBa_K2066525_sequence 1 tggaattgtgagcggataacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z