BBa_K2068005 1 BBa_K2068005 O3-33 Wild Type 2016-09-12T11:00:00Z 2016-09-13T12:57:21Z This cage is originally designed by Dr.Neil King. The O3-33 gene codes for the production of one subunit of a protein cage. Each subunit consists of a trimeric protein that is designed to have low-energy protein-protein interfaces. Expression of this subunit will lead to the self assembly of a octahedral structured protein cage.Protein cages, are self assembling supramolecular protein structures where multiple protein subunits interact non covalently to form a higher order structure. This protein cage, O3-33, is a 24 subunit, 13nm diameter cage. false false _2536_ 27134 27134 9 false This cage was computationally designed. The two steps that were crucial in the design of the cage were 1) symmetrical docking of protein building blocks in a target symmetric architecture 2) design of low energy protein-protein interfaces between the protein building blocks to drive self assembly. false Nithin Dharmaraj BBa_K2068005_sequence 1 taatacgactcactatagggaaagaggagaaatactagatgagccaggcaattggtattctggaactgaccagcattgcagcaggtatggaactgggtgatgcaatgctgaaaagcgcgaacgtggatctgctggtgagcaaaaccattagcccgggtaaatttctgctgatgctgggcggtgatattggtgcgattcagcaggcgattgaaaccggtaccagccaggcgggcgaactgctggtggatagcctggtgctggcaaacattcatccgagcgtgctgccggcgattagcggtctgaacagcgtggataagcgtcaggcggtgggtattgtggaaacctggagcgtggcggcatgtattagcgcagcggatcgtgcggtgaagggtagcaacgtgaccctggtgcgtgtgcacatggcatttggtattggcggtaaatgttatatggtggtggcgggcgatgtgagcgatgtggcactggcggtgaccgtggcaagcagcagcgcaggcgcatacggtctgctggtgtatgcaagcctgattccgcgtccgcatgaagcaatgtggcgtcagatggtggaaggcctcgagcaccaccaccaccaccactga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z