BBa_K2070027 1 BBa_K2070027 Cell cycle dependent GFPlva reporter 2016-10-13T11:00:00Z 2016-10-25T12:52:43Z To be edited To be edited false false _2538_ 31975 31975 9 false To be edited false iGEM UT-Tokyo 2016 component2505957 1 BBa_K1399004 component2505950 1 BBa_B0032 component2505948 1 BBa_J23101 component2505964 1 BBa_B0015 annotation2505948 1 BBa_J23101 range2505948 1 1 35 annotation2505964 1 BBa_B0015 range2505964 1 824 952 annotation2505950 1 BBa_B0032 range2505950 1 44 56 annotation2505957 1 BBa_K1399004 range2505957 1 63 815 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_K1399004 1 BBa_K1399004 GFP (mut3b) with LVA-ssrA degradation tag 2014-09-18T11:00:00Z 2015-06-01T07:07:29Z GFP comes from part E1010, the tag sequence was obtained from paper by Andersen et al., (1998).[2] GFP (mut3b) (see part BBa_E0040) with added LVA-ssrA degradation tag. The tag increases GFP turn-over rate, thus providing better temporal resolution of green fluorescence. In the same time, maximal fluorescence amplitudes will be lower as newly formed protein is degraded as soon as it is formed. The tag encodes peptide sequence AANDENYALVA and is recognized by ClpA and ClpX unfoldases and ClpX mediator SspB.[1] ClpA and ClpX then form a proteosome-like complex with ClpP protease and the protein is degraded.[1] The final three residues of the tag determines the strength of interaction with ClpX and thus the final protein degradation rate.[2] The LVA tag is reported to lead to fast protein degradation, degrading GFP with rate -0.018 per minute.[2] However, be aware that exact protein degradation rate depends on multiple factors: ClpXP and ClpAP protease and SspB mediator concentrations, protein stability, Km of binding to the protease, temperature [3]. References [1] Flynn, J. M. et al. Overlapping recognition determinants within the ssrA degradation tag allow modulation of proteolysis. Proc. Natl. Acad. Sci. U. S. A. 98, 10584???9 (2001). [2] Andersen, J. B. et al. New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Appl. Environ. Microbiol. 64, 2240???6 (1998). [3] Purcell, O., Grierson, C. S., Bernardo, M. Di & Savery, N. J. Temperature dependence of ssrA-tag mediated protein degradation. J. Biol. Eng. 6, 10 (2012). false false _1777_ 4206 22477 9 In stock true The tag was attached to GFP using PCR and MABEL (mutagenesis with blunt-end ligation), thus avoiding introduction of additonal residues and restriction site. Different parts of the tag are recognized by different proteins, for example, the final 3 residues (LVA in this case) are recognised by ClpX, whereas first 4 residues of the tag are required for efficient SspB binding.[1] Thus modifications of these critical residues alter the efficacy with what different proteases bind to it. false Anna Stikane annotation2383916 1 stop range2383916 1 748 750 annotation2383917 1 stop range2383917 1 751 753 annotation2383914 1 GFP (mut3b) range2383914 1 4 714 annotation2383913 1 start range2383913 1 1 3 annotation2383915 1 LVA range2383915 1 715 747 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0032_sequence 1 tcacacaggaaag BBa_K1399004_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaagctgcaaacgacgaaaactacgctttagtagcttaataa BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K2070027_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaagctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z