BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K2073013 1 BBa_K2073013 CrcB-La2 with IPTG promoter 2016-10-13T11:00:00Z 2016-10-29T04:33:09Z E.coli Fluoride ion can damage bacteria. Crcb(flc) is a kind of fluoride ion transporter, which could be transported to plasma membrane and expulse fluoride ion from bacteria . Avoid bacteria die due to fluoride. false false _2541_ 30752 30741 9 false Avoid bacteria die due to fluoride. false WEI-CHIA HSU component2502997 1 BBa_B0012 component2502996 1 BBa_K2073005 component2502995 1 BBa_J04500 annotation2502997 1 BBa_B0012 range2502997 1 592 632 annotation2502995 1 BBa_J04500 range2502995 1 1 220 annotation2502996 1 BBa_K2073005 range2502996 1 227 583 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 BBa_K2073005 1 BBa_K2073005 CrcB-La2 2016-10-11T11:00:00Z 2016-10-12T07:38:08Z Lactobacillus johnsonii NCC 533 this is fluoride ion transporter sequence form Lactobacillus johnsonii NCC 533. we reverse translate the Cecb form protein sequence to DNA sequence. false false _2541_ 30741 30741 9 false we over express the Crcb. hope the bacteria can more resistance to fluoride false YU-CHUN LIN BBa_J04500 1 BBa_J04500 IPTG inducible promoter with RBS 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 R0010.B0034 false true _16_ 0 326 16 In stock false false Kristen DeCelle component1508159 1 BBa_B0034 component1508149 1 BBa_R0010 annotation1508149 1 BBa_R0010 range1508149 1 1 200 annotation1508159 1 BBa_B0034 range1508159 1 209 220 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_K2073013_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgatcaccgttctgaccgctggtttcggtgctatctggggtgctatcctgcgttacggtatcaccaactacggtaaaaaacactggtctgaaaaattcccgtacgctaccctgctgatcaacctgactggcgcgttcctgctgggttttatcttctctcgtaaattctctccgttcatctacgctctgatcggtaccggtgttctgggtggttacaccaccttctctaccctgaacgttgaactgctgtctcactggcgtgaccgtaactactctgttttcaccctgtacgctctgctgtcttacggtggtggtctgatcctggttttcctgggttacaaagttggtaccctgatctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J04500_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K2073005_sequence 1 atgatcaccgttctgaccgctggtttcggtgctatctggggtgctatcctgcgttacggtatcaccaactacggtaaaaaacactggtctgaaaaattcccgtacgctaccctgctgatcaacctgactggcgcgttcctgctgggttttatcttctctcgtaaattctctccgttcatctacgctctgatcggtaccggtgttctgggtggttacaccaccttctctaccctgaacgttgaactgctgtctcactggcgtgaccgtaactactctgttttcaccctgtacgctctgctgtcttacggtggtggtctgatcctggttttcctgggttacaaagttggtaccctgatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z