BBa_K2074018 1 BBa_K2074018 Intron-1 Rbc S2 2016-10-10T11:00:00Z 2016-10-16T06:08:05Z The element is from the pCHlamy-3 vector 1 false false _2542_ 30527 30527 9 false 3 false Hao Feng BBa_K2074018_sequence 1 gtgagtcgacgagcaagcccggcggatcaggcagcgtgcttgcagatttgacttgcaacgcccgcattgtgtcgacgaaggcttttggctcctctgtcgctgtctcaagcagcatctaaccctgcgtcgccgtttccatttgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z