BBa_K2075000 1 Strep Tag Strep Tag 2016-10-12T11:00:00Z 2016-10-13T11:01:12Z Strep XT: agcgcgtggagccatccgcagtttgaaaaaggcggtgcgagcggtggcggcagcggtggcagcgcgtggagccatccgcagtttgaaaaa Strep II: tggagccatccgcagtttgaaaaa To verify our circulate TAL-effector we added the Strep Tag with the two linker sequences by gBlocks. We used the Strep Tag for the purification of the vector and for detection. We have decided to take a Strep Tag because this Tag does not have to be on the end of a protein so it works even if the protein is circulate. This is different to the other Tag Sequences e.g. His Tag. In one vector (iGEM02_Ax7R-RR) we used the Strep-Tag II which binds Strep-Tactin an engineered form of streptavidin. Here are two Sequences of this Tag. Everyone have a size of 24 bp. In the three others vectors(iGEM02_GFP-Hax3_2xNN (C), iGEM02_GFP-Hax3_2xNG (B), iGEM02_Ax7L-DS) we used the Strep-Tactin(R)XT enables new applications in the field of high throughput screening, batch purification, purification using denaturing conditions and protein interaction studies. It has a size of 90 bp. false false _2543_ 33470 33470 9 false No considerations. false Kim Luehmann annotation2499084 1 Strep TX Tag range2499084 1 1 90 BBa_K2075000_sequence 1 agcgcgtggagccatccgcagtttgaaaaaggcggtgcgagcggtggcggcagcggtggcagcgcgtggagccatccgcagtttgaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z