BBa_K2080001 1 BBa_K2080001 bax-sgRNA1 2016-09-21T11:00:00Z 2016-09-22T07:37:24Z Form Bba_K2080001 This guide RNA is a hundred base-long molecule with a dCas9-VP64 scaffold sequence, which can guide dCas9-VP64 to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bax, a proapoptosis protein, which can activate the transcription of bax. false false _2548_ 32616 32616 9 false We design the sequence of the gRNA that is complementary to the bax promoter region, and try to get closer to the transcription start site to obtain higher activation of bax trascription. false Haojian Li annotation2522688 1 gRNA scaffold range2522688 1 285 367 annotation2522668 1 gRNA for Bax promoter and Bax-1 promoter range2522668 1 265 284 annotation2522665 1 U6 promoter range2522665 1 1 264 BBa_K2080001_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgtcatctataacgtcctgccgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z