BBa_K2080008 1 BBa_K2080008 bax-sgRNA4 2016-10-12T11:00:00Z 2016-10-13T05:10:58Z From BBa_K2080000 This guide RNA is a hundred base-long molecule with a dCas9-VP64 scaffold sequence, which can guide dCas9-VP64 to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bax, a proapoptosis protein, which can activate the transcription of bax. Sequence and Features false false _2548_ 32616 32616 9 false We design the sequence of the gRNA that is complementary to the bax promoter region, and try to get closer to the transcription start site to obtain higher activation of bax trascription. false Haojian Li annotation2523829 1 U6 promoter range2523829 1 1 265 BBa_K2080008_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgctgatagatcagcagggtagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z