BBa_K2080005 1 BBa_K2080005 bcl2-sgRNA2 2016-09-23T11:00:00Z 2016-09-24T08:45:04Z BBa_K2080000 This guide RNA is a hundred base-long molecule with a dCas9-KRAB scaffold sequence, which can guide dCas9-KRAB to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bcl-2, a anti-apoptosis protein, which can inhibit the transcription of bcl-2. false false _2548_ 0 32616 32616 9 Not in stock false We design the sequence of the gRNA that is complementary to the bcl-2 promoter region, and try to get closer to the transcription start site to obtain higher repression of bax trascription. false Haojian Li annotation2523820 1 gRNA scaffold range2523820 1 286 367 annotation2523818 1 U6 promoter range2523818 1 1 265 annotation2523819 1 gRNA range2523819 1 266 285 BBa_K2080004 1 BBa_K2080004 bcl2-sgRNA1 2016-09-23T11:00:00Z 2016-09-24T08:41:36Z BBa_K2080000 This guide RNA is a hundred base-long molecule with a dCas9-KRAB scaffold sequence, which can guide dCas9-KRAB to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bcl-2, a anti-apoptosis protein, which can inhibit the transcription of bcl-2. false false _2548_ 0 32616 32616 9 It's complicated false We design the sequence of the gRNA that is complementary to the bcl-2 promoter region, and try to get closer to the transcription start site to obtain higher repression of bax trascription. false Haojian Li annotation2523810 1 gRNA scaffold range2523810 1 286 367 annotation2523785 1 gRNA range2523785 1 266 285 annotation2523775 1 U6 promoter range2523775 1 1 265 BBa_K2080011 1 BBa_K2080011 bax-sgRNA-12 2016-10-12T11:00:00Z 2016-10-13T05:51:21Z From BBa_K2080004 BBa_K2080005 This is a group of guide RNAs that have a hundred base-long molecule with a dCas9-VP64 scaffold sequence, which can guide dCas9-VP64 to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bax, a proapoptosis protein, which can activate the transcription of bax. false false _2548_ 32616 32616 9 false We design the sequence of the gRNA that is complementary to the bax promoter region, and try to get closer to the transcription start site to obtain higher activation of bax trascription. false Haojian Li component2499786 1 BBa_K2080005 component2499785 1 BBa_K2080004 annotation2499785 1 BBa_K2080004 range2499785 1 1 367 annotation2499786 1 BBa_K2080005 range2499786 1 376 742 BBa_K2080011_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccaatgaatcaggagtcgcggggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttttactagagaaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgatcgattcccagacttctggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt BBa_K2080005_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgatcgattcccagacttctggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt BBa_K2080004_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccaatgaatcaggagtcgcggggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z