BBa_K2080003 1 BBa_K2080003 bax-sgRNA3 2016-09-21T11:00:00Z 2016-09-22T11:22:54Z From BBa_K2080000 This guide RNA is a hundred base-long molecule with a dCas9-VP64 scaffold sequence, which can guide dCas9-VP64 to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bax, a proapoptosis protein, which can activate the transcription of bax. false false _2548_ 32616 32616 9 false We design the sequence of the gRNA that is complementary to the bax promoter region, and try to get closer to the transcription start site to obtain higher activation of bax trascription false Haojian Li annotation2523854 1 misc range2523854 1 285 366 annotation2523851 1 gRNA range2523851 1 266 284 annotation2523831 1 U6 promoter range2523831 1 1 265 BBa_K2080012 1 BBa_K2080012 bax-sgRNA-34 2016-10-12T11:00:00Z 2016-10-13T05:50:56Z From BBa_K2080003 BBa_K2080008 This is a group of guide RNAs that have a hundred base-long molecule with a dCas9-VP64 scaffold sequence, which can guide dCas9-VP64 to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bax, a proapoptosis protein, which can activate the transcription of bax. false false _2548_ 32616 32616 9 false We design the sequence of the gRNA that is complementary to the bax promoter region, and try to get closer to the transcription start site to obtain higher activation of bax trascription. false Haojian Li component2499847 1 BBa_K2080008 component2499846 1 BBa_K2080003 annotation2499847 1 BBa_K2080008 range2499847 1 375 741 annotation2499846 1 BBa_K2080003 range2499846 1 1 366 BBa_K2080008 1 BBa_K2080008 bax-sgRNA4 2016-10-12T11:00:00Z 2016-10-13T05:10:58Z From BBa_K2080000 This guide RNA is a hundred base-long molecule with a dCas9-VP64 scaffold sequence, which can guide dCas9-VP64 to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bax, a proapoptosis protein, which can activate the transcription of bax. Sequence and Features false false _2548_ 32616 32616 9 false We design the sequence of the gRNA that is complementary to the bax promoter region, and try to get closer to the transcription start site to obtain higher activation of bax trascription. false Haojian Li annotation2523829 1 U6 promoter range2523829 1 1 265 BBa_K2080003_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgggcagcggccattttgcggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt BBa_K2080008_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgctgatagatcagcagggtagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt BBa_K2080012_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgggcagcggccattttgcggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttttactagagaaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgctgatagatcagcagggtagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z