BBa_K2080005 1 BBa_K2080005 bcl2-sgRNA2 2016-09-23T11:00:00Z 2016-09-24T08:45:04Z BBa_K2080000 This guide RNA is a hundred base-long molecule with a dCas9-KRAB scaffold sequence, which can guide dCas9-KRAB to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bcl-2, a anti-apoptosis protein, which can inhibit the transcription of bcl-2. false false _2548_ 0 32616 32616 9 Not in stock false We design the sequence of the gRNA that is complementary to the bcl-2 promoter region, and try to get closer to the transcription start site to obtain higher repression of bax trascription. false Haojian Li annotation2523820 1 gRNA scaffold range2523820 1 286 367 annotation2523818 1 U6 promoter range2523818 1 1 265 annotation2523819 1 gRNA range2523819 1 266 285 BBa_K2080004 1 BBa_K2080004 bcl2-sgRNA1 2016-09-23T11:00:00Z 2016-09-24T08:41:36Z BBa_K2080000 This guide RNA is a hundred base-long molecule with a dCas9-KRAB scaffold sequence, which can guide dCas9-KRAB to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bcl-2, a anti-apoptosis protein, which can inhibit the transcription of bcl-2. false false _2548_ 0 32616 32616 9 It's complicated false We design the sequence of the gRNA that is complementary to the bcl-2 promoter region, and try to get closer to the transcription start site to obtain higher repression of bax trascription. false Haojian Li annotation2523810 1 gRNA scaffold range2523810 1 286 367 annotation2523785 1 gRNA range2523785 1 266 285 annotation2523775 1 U6 promoter range2523775 1 1 265 BBa_K2080013 1 BBa_K2080013 bcl2-sgRNA-12 2016-10-12T11:00:00Z 2016-10-13T05:56:37Z From BBa_K2080004 BBa_K2080005 This is a group of guide RNAs that have a hundred base-long molecule with a dCas9-KRAB scaffold sequence, which can guide dCas9-KRAB to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bcl-2, a anti-apoptosis protein, which can inhibit the transcription of bcl-2. false false _2548_ 32616 32616 9 false We design the sequence of the gRNA that is complementary to the bcl-2 promoter region, and try to get closer to the transcription start site to obtain higher repression of bcl-2 trascription. false Haojian Li component2499912 1 BBa_K2080005 component2499911 1 BBa_K2080004 annotation2499911 1 BBa_K2080004 range2499911 1 1 367 annotation2499912 1 BBa_K2080005 range2499912 1 376 742 BBa_K2080005_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgatcgattcccagacttctggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt BBa_K2080004_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccaatgaatcaggagtcgcggggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt BBa_K2080013_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccaatgaatcaggagtcgcggggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttttactagagaaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgatcgattcccagacttctggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z