BBa_K2080007 1 BBa_K2080007 bcl2-sgRNA4 2016-09-23T11:00:00Z 2016-09-24T09:03:47Z BBa_K2080000 This guide RNA is a hundred base-long molecule with a dCas9-KRAB scaffold sequence, which can guide dCas9-KRAB to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bcl-2, a anti-apoptosis protein, which can inhibit the transcription of bcl-2 false false _2548_ 32616 32616 9 false We design the sequence of the gRNA that is complementary to the bcl-2 promoter region, and try to get closer to the transcription start site to obtain higher repression of bax trascription. false Haojian Li annotation2523747 1 U6 promoter range2523747 1 1 265 annotation2523774 1 gRNA scaffold range2523774 1 286 367 annotation2523760 1 gRNA range2523760 1 266 285 BBa_K2080006 1 BBa_K2080006 bcl2-sgRNA3 2016-09-23T11:00:00Z 2016-09-24T08:48:20Z BBa_K2080000 This guide RNA is a hundred base-long molecule with a dCas9-KRAB scaffold sequence, which can guide dCas9-KRAB to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bcl-2, a anti-apoptosis protein, which can inhibit the transcription of bcl-2. false false _2548_ 0 32616 32616 9 It's complicated false We design the sequence of the gRNA that is complementary to the bcl-2 promoter region, and try to get closer to the transcription start site to obtain higher repression of bax trascription. false Haojian Li annotation2523812 1 gRNA range2523812 1 266 285 annotation2523746 1 U6 promoter range2523746 1 1 265 annotation2523814 1 gRNA scaffold range2523814 1 286 367 BBa_K2080014 1 BBa_K2080014 bcl2-sgRNA-34 2016-10-12T11:00:00Z 2016-10-13T06:01:03Z From BBa_K2080006 BBa_K2080007 This is a group of guide RNAs that have a hundred base-long molecule with a dCas9-KRAB scaffold sequence, which can guide dCas9-KRAB to its complementary part of a double-strand DNA. In our project, this gRNA is targeting to the promoter of bcl-2, a anti-apoptosis protein, which can inhibit the transcription of bcl-2. false false _2548_ 32616 32616 9 false We design the sequence of the gRNA that is complementary to the bcl-2 promoter region, and try to get closer to the transcription start site to obtain higher repression of bcl-2 trascription. false Haojian Li component2499913 1 BBa_K2080006 component2499914 1 BBa_K2080007 annotation2499913 1 BBa_K2080006 range2499913 1 1 367 annotation2499914 1 BBa_K2080007 range2499914 1 376 742 BBa_K2080006_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccaccggagatctcaagagctcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt BBa_K2080007_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccatcaatcttcagcactctccgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt BBa_K2080014_sequence 1 aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccaccggagatctcaagagctcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttttactagagaaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccatcaatcttcagcactctccgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z