BBa_K208003 1 BBa_K208003 OmpA Signal Peptide - Silver Fusion Compatible 2009-10-11T11:00:00Z 2015-05-08T01:11:24Z Anneal OmpA false false _310_ 0 3473 9 It's complicated false Silver Fusion false USU iGEM 2009 annotation2034604 1 OmpA range2034604 1 1 63 annotation2034605 1 Start Codon range2034605 1 1 3 BBa_K208003_sequence 1 atgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcaggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z